Description :
From Genome Similarity Track
Location :
Scaffold_7:529755- 533806
Transcript NameFunction/comments
Phyin_T30-4PITG_05128Putative uncharacterized protein

Sequence
4051 bases(100 bases per row)
GCTTTCTTGGTAGTTGACTTCGTAGGGGTCGCAACAACTGGAGCTGACGTAGTAGGAGTCTCTGACGCTGCTGTAAGCGACGCCTTCGTCCCAAGATCCG
AGCTCGATTCCGTCGCTCCGACGGGGATCGGGATCGGCGGGGGCGACGTCTTGTGCTTCATACACTGGATGATAGCGTCGAACGACGTCTTGATCGACTT
AAGTTCGTCCATTCCGGTGGGTTTTTTATCGATAGCGAGCTTCTTTCTCTGCGCCAGTGTCATCTCCACTAAGCTGAGTTCACTCACGATGGAAGCAGGT
GGTAATCCAGGAAACGAGTGACATTGCGGGAACGTGAGTAGCAGCTCACTGTGAGGCAAGCCGATCCGAGTATCCAGTACAACAGACGTGAGTTGCGCAG
CCGCCACATTCGCAGCGGCAGCGGCACGTTGCGCTTTCAACGTGCTCAACTTATTGTCTTTCAGAACAGAAGCACCCGTGTTAGCAAGACTACCGGAGAT
AATCTTGCCATAGCGATCGTAACATTGTCGTGGTGACCGCTTCTTACACACGAAGCGAGAGACTGCAGTGGACGAGTTAAACACCTGAGCGATGAGCGTC
CAGTTGGCGCCGTATAGCTCGAAGAGTTTCTTGAGAATGATGTCGTCATGCACACTCCAAGCGTCACGTCCAGAGTCCGACGACATGCTGCTCTTCCGAG
CTCGTCCGGTGCTCGTCTTGGACTTCTTGGAGCTCTTCTGCGAGCCTGTCTTCGAGGCATCCGCTCCAGTAGCACTCGCAGCGGTCGTCGTGCCGCTGGA
CGCCGTACCTGACGAAGCAGTCGATGACGCTCCAGTGCCAGTACCTACACCAGCACCAAGAATGCCGCTTAGAAGCGCAGGATCGTCCCATTCGGCCGAA
TCGAGCGCATCCAAGTTCGTATCGCCCCAAAAATCGTCGTCAGCAAACTCCGATACATCTGGGACCGGTATGCCTTCTAAATCCACACGCATTTCTTTCT
GAGACGCCGACTTGATCCCTCCCAACTGCGACTCCAGCTTGCGTTTAACACCTGAGGATACAGCAGCAGTACTTGAGCTTCCAGACGCCAATCCAAACAT
CCCAGCTCTCGCCACAGCAGCTCGTTGCTTCTTGTTGGACTTACTGGGCTTAGAAAAGTCTCCGTGTCCAACAGCTTGGTCCAGTTTAGATTTCCCCGGC
AATGGCGCGGGGACAGGTGCTTGGGACACGATACGACACTCGGAACGTCATCTGGTTTGCTCGTATCCGAACCAACGTCCGGTCGACACACGCGCCACAC
TCGACATTGGAGGGTTCTGGGAGGTTTGTAGACGTCGAAATGAGTCTCCATCCCCTCCATACGCATCTGCATAAACACCTTTTCAAGCGCAATGTCCACA
ACGCCATTGTAGCGAGTATCCAGCGTGAAAAAGAGCTGCGAAGTGGCGTCTCCTTCTTGCCACTGACGATTGGCTTCCAACGTTGCCAGCTTCTCGAATG
AACGCTCGTCTGACTGGAGGAAGACGTTGCTATCGTTCCAAAACGCTGCACTCTCCTCTTCATTACTCTCGGCGCTTTCAACAGTCTTGCCTTCTCCTTC
CTGCTTCTTGTCAGTAACGTTGTGTACGTAGTTAACAGCATACCATTCCACAGGCGTCAGCTCGTCCGTATTAGCCAATAAGAGATGTTCTTCAGCATCC
AGATCCACATTATGCACAATGAGCGGCGCTCCCAACTCGTTGGCATCTCCACAATACTTCTCATCACTCTCCACCTGCTGAGCTACCTGCGTAAGTCTCG
CCATAGCTCCCGTATCCGTCAAACCGTTCCCACCGCTACTAGTGGCAGTTGAAGACCACCAGCTCGGCTTTTCGATCGTCAAGCTTGGCGTCATGTCCGA
TGGCACAGCCAGAAGTTCCTGGGGACTCATCTCGCCGAATACCTTCTCCGTGAGCGACGCTCCCACACGTAACAACGACGCTTCAATGGTATTCTCGCAG
TGTAATCGGTAGACTGGCAGCGTATCAGCGCCACCCACAGCCATTTTGGCCCAACTTGCACGGAGTTTAGCGTCACAAGTAGCGTTCCAGTCTCCGTCCA
CGACGATAATGGCTTCACTTCCAAATACTGACACTGCTCGTCTCCCATTGGACATGGACAATCGAGTAGACGCTAGTGCTACACGCACCACTGCGCGATC
AGCGAAGTGACACAGCGCACGACGCTGCATGGCAACAGATCCAGTCACACGTACGTAGTTGATATCTAGCAGAGACAGGAAAAACTCCAGTACAGGGAAC
ATGGCGTTGAACTGGCAGTAAATCACCACCTTCTTGCCTTCCTGAAGCAACAGTCGACGTAGCAGTGGCTCCAGCACTTGCAGTTTCGCAGAACAACTCG
TAAGCAAGCGCATATCCGCGTGTCCCAACTTGTCCATATCATTCACAAGATCGACACAATTGCAGATCTCTCGAAGACGAAGCAGAAGCTGCAGCCATAC
ACTTAAACGCTCTTCACGGCCACTACAAGTATCCAGAGTAGCAGCGAACCCAGTCAACACGTTGCGGTACTGCGTCCTTTGTGACAGACTGGGTTGACAA
CTCAAGCTGATCTCGTCGATCTTGCCAAGTTCCGACTCGACTTCGCTCCGTACACGTCGCAAACTGAGACAAGATAACGCCACAAGCAAGGCATTCATGT
ACTGCGGAGTGTCCTCCTGCGATGCAGCCTTCCACAGCGACGCTCGGACACTGGATGACTTGCCATACAGCTGCATCACCTCCGCCACAGACGCTCTCTC
CACGTTCAACTCCTGCACTGGCCACTTCTCCACTCGATGGCGTCGTTCAGTCACATGGTCATCCGACGCTTCTCGCACTAGAAACTCAGCGTACTGCAGT
CGTAGTGCAGTGTTTTTCCAATTCTCAAGCGACTGTCCATTGCACAAGACTCGTCGCTGTCGTTGTCGCAGTTGCTGCAGCGCTGAGACACAGGCCGCAT
CTTCAAACTGCGCTCCATGCTCGTTTTCTACTACGACCATCTGCCAGTTCGTGAATGCCACAAACGCATCTCGGTCTTGAGCAAATGCACTCACGGGGCA
CAGCACACAGTAAATAGGGTCGTATAGTTCGTCCAAGTCCAGCTCGTCGTCGTCGTCGTACGTAAGAAACGCGTCCTCGGTCTTGTGTGCTTGAGCTCGA
GACTTCCTCTTCCACTCCCGCTGCAGTTGTTCTCTACAAGACGAGGTACTACCAACACCATCATAAAGCTGAATACGCCGACCTGGGTGCCATATCCGAA
GAAAATACCGCCATTTATGCAGCTCCTCCTCCGACACAATTATCAGATGCGGACCTGTCACCTGGTCTTCTGTAGTTACAGTCGTCTCGTCGCCGTGTTG
CTTCTGAGAAGACACGATCTCGATGAGACTGAGGAAAGCGACGATAGTTGTTGCCTTGCCCATACCAAGTTGGTCATTCAGGAAAATGTTGAGACCGCTA
GAATACAAATCCAGCATCCACCGCAACGCCAGTAGCTGGAAAGCAGCCAGAATAATGGTAGGACCTCCCGTAGTCTGTAGAGCAGTACACCGAGCTTGTA
GATCCCGGAACGCTGCTTCACGTAGCGACCATGTCGACGACTTATCTGCATCTTCTGCAGTCGAAGAGGTCATCGCACTGCGAGCACGTTTGCCAGCACT
CACGATGTACGTCATATGTGTCTTAGCTGACGCCAACACTGCGTCAGCCTTTGCTTCTCCCTTCTTAACATTAGCTCCATTGCTCCGAGCGACTTCGATA
GTGTGGTATTTCAACGCCAAAACACCGTCGGATGTGCTAGCCACATCCAGATCCTCGCTCTTGCTTCGCTTGCCGTCATCCTCAGCATCTCCCGACATCG
GGTCGTCAATCTCGCCTTGATCCGTACCTGCAGCTTCAAAGCGAACTCGTGATCTCGCAGCGATCCTCTCCATCGTCCGCCAAAAGGCCGAAATCTGCAA
CGCAATGCCACGCGCCATCTGACGATTCTCGTGCTCTTGACGCACACTTTC