Description :
From Genome Similarity Track
Location :
Scaffold_365:5297- 9402
Sequence
4105 bases(100 bases per row)
AATTCATAAATGCTTGAGACGCACCACTTACCCTCAATATCTCAGCGCTCTGCTGCCAGTCACACACGTCTGTCATCTTACCGAGACGCTTCCATGCAAT
CTTGACTATGGCAGCTGTCAGCGGTCCAGTGTGCACCGCATTGCCGATTGTCAAATTTTTGAAGCCGGTTATCACCGCTCACCATTGTGAAATAAGTGTC
TGTGCAATAGCAGTCGTCAGAGCCGTCATGAATGCTGTCGATGAATTTGCCTGAAGCGACGGATTTGCCATTTCTCGTCCGGTACATCTTGTATCTCTTG
CTTTGTTAATAATTGTAATGGTGATAGTGCCGTGGTTAGGCCAGTGCTTCAACTGCAGTCTCCGCCCAAATTTCCGCGAGCTTCCTGAATTGCTGTCACT
TTGCGTTCATCTGCATTTCCGGGCGCAGACCCTCCACTGACGTGAGCGGAATCCGCTTATTCGCGTACTCGACAACACTTGACCGTTTTGCAATCACCTG
CCTTGGAAGAAGGCGCAAGATGTTGTCCTACCAGTCCGTCAACGTCGCGTCGTTCGATCGTCGGAGATCTGGGGCCTAATTTGTTTCACAAAGGACTCAC
GAATAGATCGCTCGTGTCTCGTGCACGCGAGGCATATGATTTTATTTGCCCTGACTGGTATTGAATAATTCCGTTAAGTTCTGTATTGGTCCTACCTCCA
TCATTTAGCAGTAAACCCGCAATGAGATCATGGAAAAGAACAAATACATGGTGACGCACCAGGTTACCTATAACATATCCCTCGTGCAGCCAAAATGCCG
CACTTGTAACACGAAATTGTTGAGGCAGGCACAAGTGAGGTGCTGGATCACATCGAATCACGCTACCATTTATCCTGATGAAGACAAAATTGATGCATAC
AAGATTGCACGCTTGCGCAGGAACGATCCCATGGGGGGTTTGCACGAGCAAAAGCTTCTAAACGCGAGAAGGTCTCACTCGTTAAACCAATTTAAATATT
CAAATTGCGTCCTCTAGTAATGTAAGTGTAAATTACACTTAGTTCCCACCTCGTCGCACATTGCGTCATTAGTCTATTAAATGGAAAGACTCGTTACCAA
TCATGAAGTACCTTATCCCATGTTGCAGTTGGGTATAATGTGGTAAACACTATTTATTCATCTAATTTATACTTGAGTTGAGTATAGTACTGGTTTTGGG
ACTTTTGCACATTTGAGGTACTAATACTGAGATTTGCTCTTGTGGTACATCATACCCCAAGATTTACCTTCGATTTCAAACGTGCAGACCGAGTTGGACG
CCACGATGTCCATTGATTCGGGACTTTTTGCCGTGCTCGTGTTGTAATTTCTATTGGAACTATGCGCTTACTGGTTTCGTACTTAGTCCGTACGGGTACG
CGGTAGTGGCTTTTTGCTAGGTGCGAAGCTGCAGTCGATCCTCGATGTTAATTACGTGGCAATCGACTGTCACGACACGCTCATTGACGCCATGGAATTG
GCACGGGGAAGTGTTAGATTTTATAAGTTGAGATTTTGCTGTAAAATTAAAGTGATATTGTTTTAACGTCCAACAAACAATGTTTCTTACGCTCTCTACC
ATCCAACCATTTTATAAACTGGTTTTGACTGCACCTGCCTGCTGAGAGTGGTCGGCCGAACTTCAACACACTCTCACCATCTTGCATTTCCTTCAATACT
CCTCCTCGGTCGTCGCACTCTCGCCCACGATCAATTTCTACAGCAAATTAAATAGATTTCGTAGTTCGGCAATCCTTTGCGCCGGCAACACTTTTGCCAG
CAGATCCGCCTTCATAATGCGCAATTCCACAAACTTTGGTTTCACGATGTCCTTCCTCACATAATCGCATATAAACGTCATGCGCACGTCAACGTGCTTG
ACACTCGATTATACTTCCTTCAGTCTCCAGCTGTCTGATAGCGGCCTGGTTGTCCATGAGCATTGACATCGGGGCCTCCACTTGAAATTCAATCTAGCGC
ATTTATTCTCTCAGTCCTAGCAATTCTCGCCCAACGTGCAAGGCCGACGCAAACTCGGCCTCCATTGTCGACAGCGACACCCCGGTCTGCTTTTTGCACA
CCCACTGCACAATAGCACCGTCCATGGTTAAAACTCCGCCTGTGACAGACTTACAGTCCGCCTTATCAGCCGCATATTCCGAGTCGCTCCAGCTCGCCAA
AATTGACCTTGTTTCCTTCATTCCTTGGAAAAATCATCTTGAGCTTTAGGTTCTTAGTCTCCTTTAAGTATCTGGACACTCCCTTTCTCAGCTTCCAGTC
ACTCATAGTAGGTTGGTGAGTGCGCCGCGTGGCCTTGTGCACTGCAAAGCTGATATCGGACGTGAACATCTAGCAATCCATAGTAAGCTCCCCACAAGCG
ACTGAAAGTCGCGGATCGTTGGTTCACCTCTTTGTCTCGGTACCGTTGTCAGCAACACAGGGTCCTTCTCCACTTCATTAGCTTCTTCACCGATAGGTAC
ACGAACACTATTCGCCTTCATGAAACCATGATTCTCAAGCATTTCTTCAATAGTCGCCTGTTGGTCCAACGTGCACGTGTTTTCGTCCTCAAAACTAACT
TGCATCCCTAGAAACTTGCGAACCTCGCCCAAATCTTTGATCGATAAACATGCTATCGCCTCGAAAAACAGCTCTACCATCCTCGGACTAGACGCTGTGA
CTAGTAAGTCGTCCACGTAAACGCCGACAATCGTCACATCGTCTCCCTGGTGCTTATAGTACAAGTACATATCGGTTTCACACTGCGTGAATCCTGCCTC
TTCCAGCCTGGTGTTTAGCAGTTTGCTCCACAGACGGCCCGCCTGCTTGAGCCCATAAAGAGACTTCTTCAGTTGTAGCGCTAGGTACGATTCGTCTTGT
ACGCCATATTGTCGTAGAGTGCCATCTTTGATCTTCACCCCCTATGGAATCGCCAAGTGGATATCCAAGTGCTCTTCTTTGTCAGCCTTCACGTACGCAT
TGGGAATGTCCCCGTGTCTTGCCGGCAACTCCCCAACGTAACGCAAGCACTAAAATCACCTTCACCATTGCTCAATTCCATAACAGCACAAACGTAAGAC
CATAGTCAACGCCATACACCTGCTCATTACCACAGGCAACCAATCTCGCCTTGAATAGTTCAATAGCTCCATCAGGATCCGTTTTGGTCTTGTAGACCCG
TTTTGTGTGCAGCACGGTGACTATGATTTGGTGGCACTACGACCAACCAAACTCCGTTGTCTTCGAACGCTTGCAGCTCTTCCGACATTGCAATACGCCA
CTTTTCCTTCTGCTCACTCTTTATGGTTTGCCCGTAATTCTTCGGGTCCGCCCCCCGCACGCTATTTATCAATTCACCAGGCTGTTCACTTTCTTCAACG
TTTCTGCGTGCCTTTTGCGCCGCTGTCCTGGTCATGTGCGCATCGCGCGTCCAATACGCGTCCTTTGTCCTCGTCCCTTGCGTTTCCCTCCTGGAACCGG
TATTGGAGTTTTTATCGATGCATAACCGCCATTATCGCCGATTTCTTTATCTTCCTCCGTTAGATGCACATGACGTAACTGCGCATTCTGCTCCTCGGTC
GGATTCTTCTCGTTTCGAACGTGTTGCGTGACGATGAAGATCTTCTCCCTTGGCAAAAACCTTTAGCCTTCATTTCATCGCTCTTGCCGATGATGATACC
TTGTTTTCCACACTCACCCAGCGACTTGTTACTCGTATTTCCATGTACAGTGCATGGCGAGCCAAAATCCACTATGTCGCTTAAGTCTGGGATGCTCTTC
GTGAGCATTTGCAACGGTGACTGTCTTCCCATATTCGATTTGCTCGGACTCCGGTTAAGAATATACACCGCATATTCCGCGGCGTCTCCCCAAAAGCTTA
ATGGCAATCCACAAGCGAAAAGCAGGCTCCGCACCATGTTCATAATGGTGCGGTGCATCCGCTCTGCATTTCCGTTACTTGCTTGGTTACGTGGCTCGCT
CATCTGCCGCGCAATACCAATATCCTTGCAGAATAGATCCAAAGTCCTGTATTCCCCTCCGCCGTCCGTCCTCAAACGTGAATCCGACAGTTGATTTGTC
GCTCG