Description :
From Genome Similarity Track
Location :
Scaffold_52:52955- 58388
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_52-snap-gene-0.27MFS amino acid transporter
Pytap_DAOMBR444maker-pag1_scaffold_52-snap-gene-0.35Bzip transcription factor

Sequence
5433 bases(100 bases per row)
AgTtAAAGCtaTCGAAGCTTCTCCCAAATGGCGActAGTACCTTGTTATGGAACAGTAAGaCATGATCAGTCCTcAAAATGCACTTGACGGGGATGTTGT
CATGCCGGTAGGTGAGACCGCATTGTGTCTCTCCCCCtCcGCCCGCATGACGCTCCAGCCTCCTCAGTCCCCACACTACGAGGCCCTTAACGACGGCTCT
GAGGATtCGTTGTCCGCCTGGCGCCTGCCACGCGTCGCCGTCATCGTTGTGGTCGCAGTGCTCGTGGTGCTCACCTCTGGCGGTCTCATCCTCGGCTTCG
GTCCTCTCTATTCGCTGCTCGTGGATGAAGGCCAGTGGCAGGAGAAGTGTACGCCACAGGAACGTGCCAAGGCCCAGGACGACGGTGCGCTCACGTGTGC
GAGCCAGGAAGTGTATCTGCAGTACATCTACTCGACCGCGTTCCTGTGTCTGAGCGCTGCGAATGCgTTCTTCGGACTCTTCCTCGACATCgCCGGCCCG
CGACTCAACGTTGTGATTGGTCTCATGGTATCACAGGAGCTCGTGCACGATGGTagATGAGAATGCGGCGCTAAGTCTGGGTATGCGCGTTCACAGCTAT
CGGTTCTGGGCAACTTCCTTTTAGCATTTGGAGAATCGACGACCAACAATGGACTAGCGATCATCGTGGGCTACTCGCTCGTTGCCATCGGCGGCTATCC
TGTGTACATTGCGTCGTTCCAGTTTGTGCAGCTCTTTGAGCGTCAGGGGCTTGTGTGTAGCTTGATATCCGGGCTATTCAATGCGTCAGGCACGTGCCCT
CATGGCGAAGGTCATCCGCCGTAAACTGTCTACTGATGATATCTATTTACCGACTGCAGGTTACGTCTACATGCTGCTCATGATCGGCGGCATCACGCGC
AAGACATTCTTCATGAGCTATGGGTGTGGTGCATATCCTGTATGCCAGTAGCTCATAACCTGTTCTAACTGTTTATCTCCATTAGATTCTTCATCGTCGT
ATGCCTCGTCGTCGGCTTTATTGTGTTCCCCACTCAGTCTATTGCCAAGCCGGCATCTCACTTCACATTGTCAGGGTTCAGCTGCCAACGCCCTCAGTTT
GTCGTAAGTATTGCTGATTCCACGACTtCTCGAGTAACAAACTCACAAACACAAaCGAATCATGTGACTGTAGAGACCAAAGGGACTTTGGTCAGgaCTG
AAGCCGCAACTTCGACGACTTGATCTCTGGTATTTTGGCATCTACTTCGGGTGGATTTCGACCATCTTTGCCTTTGCTGGTAGTGCATTACCAAaCATCA
TTTACAACAACGACGGCGGCGACGACGACACAGCTGGGATCTACGTTAACTACCTCAACCCAATTATCGTGAACGGCACGTTTATTTACAcTCCCATTGT
CGGCTACATCATCGACAAGTTCGGATTCCGCCCAGTTTTCCTCGTCACCCTCGTCCTCGTGCATCTCTTTCTGGGGGCGCTCTTGATTCCATCTATGAAG
TCTCAAATCTTGACTCTGATCCTTTTtGCAATGGCACAGGCGTCCTTCTACTCGCTCCAGTTCTCCTACATCGTGATATGCTTCCCTGGCGAGGTATACG
GCTCATTGCAGGCATTCCTCGCTGTGTGCTCGTTCACCATGGGACTTCTGAATTACGTGTTTACGCCATGGGTCCAGAACCGATTGGATGGTGACTACAT
GCCTGTGTTACTGCTCATGGCCGCGCCAGTTCTATTCTTTtATTtCTTCGTCCGTGTTGTCAAGTCAGGACTCGACCAGTCACGCGTCAGCATCGATCAG
TCTACAAAAGTGTAGCCATATTACTTCTGATAATGCTACTGTTAAAGCAGTAGAACGTCTTCATTAcTtGCTTAAacTTCAACAATCTATTGATTCAACG
CTAACTGTTAACGCGTTCTGTACACACAACTGCCACTAACACTATGCGCACGTCTCCATTCGAGCGACAAAGCGCCTACACCATCACAAAGTCATCTCCT
TTTCCATCATGCAGCAGTATGCACTCGTCTCCACCATCGTCGCTCAGGAGAACTTGTCGACGGATCTCCACCGGTGAAGACCCGTCTTGAGACCAAATAT
CCAAGTCGGACTGCTTCTTATGGTCCCTTCCACGGATATAATTGTTAGCTGGCCCTGTCGGCACTTCGACAAACCGGTCGCTTTGAAGGCCATGCTTGTC
TGTCTCTTCTTGGTtgaTCATGCTATCGCCAACCAGATATGCaTCTCGAACGATTTGGGCTTGTTGAAGCACAACGGCCGTCTCGTCAATCGTGAGTACG
TGATGAAGCGCCGTCACGAAGTCAATCgTCCAATCCACTTCTACAACCATTCCGTCTTCGTCAAATACGTACACAGCCGAnGCCGGGCACgCCAGACGct
GTCCAATGAGCTTCCACTTGACTAACTCGTGTTGTGGGTGTTGAAGATGTGGGAAcACGaaCTGGATCGTCGCATGGGAGACCGTAACCTCCATGTGAAT
GGTAGCTACTACTGACGTACAAAGGTCGTgAGTTGTGACGCTCTCAAACTTGATCAATTCGATCAAGAGGCCGTCGTAAAACGTCGAAAACCGACGCGTT
TGGTCAATGAAGCTATCTCGCCCAAACACAgCGTCCATGCGCACATTGCGGTTGAACGTATACGTTAAAAATTCAAGCTGCTGGTCGACGTGAGGCAGTC
GTTGTCGTAATtGAGAATGAGAACTGTGTCGATGAgCCATACCCCCTCGGATGCTATCCTCCGTGACGTTCAGACCATGCCTGAACAgTCGAAAGTACTC
caTCACGCCTTTCAACGCCGACTCACGAATGTTCACTCCATAGTACAGCTGCGCTCTCTGTTCTTCCAGCTGACGCACTTCATTGCGTAGCTCTTCAACC
TTGTTCTCGAGTTCGATGGCGAAAAGTCTTTGTTTATTGCGGTACCTCTCTTGGTtGCGGCGACACTGCTCTCGGCGGCGCTCCGTTTTGATGCGAATGC
GTTTCTTCTTGACTGGTGCCgAAGCGGCGCTAACGGCGGTTGTGGTGGTCAATTGCGCCTCCGATGCTGATGTTTGTGCTTCTCGAGCCGAAGATTGGGA
CtGTCCAAGAGGCTGAGCTGGTCTGGATGCCGATGATGaGGACGACTGGGTGGATGCAGCTTCCTGGCTCGCATTCAGTGCtaGTGACCGCGCGGACGAT
GGCGGGATGGCGGCCGCGGTCGCGcGGTAGTCGCCcGACGTCCGCagTCGGCTCTGTGTCGTCATCCAGGACGcaGACGTGaCAACGCTGTGAGCGCTCA
GCATCCCGCGCTCGGTGAGTGCAgATGACTGTGGACGCAGCGCCATGCCGATagATCACTGGGTTGGATATCTAATACTGGATGGGAtGGCCTGGAATCC
AGATATGTGGAAGCTGCAACTCGATCCCGCGGGTACTGATATCGGATAGGCCAGCACGTCCACCcGTCCCGGATTAGACCTGTTGTCGGGAGAGACTCaC
ACCCAGACGCCGCCCACACTGCGCTCTTGTTTCCTTCACAGTGCCGTCCTTGTGGCCAACTCGCGAAGTGAGTCGTTTCCtCTTCTCTCACGCGtGTTTG
gTGAGAGCGGACGACAGAGATCACGTCGTGGTCCCTCCcGcAATCGCGTCGGCGGTTGGCTGCTCAGCTCACACGTGCGTGCTGAACTCGTcGGCTTCGC
ACGGCGCAGCTGGCGAGTGTTCATGAGCTCGTCCCGAtCTCTCTCTCTCTCTCTCTCTCTtCCcATACAGCATGGCCGTTGGaTTtGAAaGaGATTtAGA
CCTGCTTtGGAACCGCATAATGCCATGGACTGGGCAGTCGGACGgATTGGTCTAACAAAaTCAACTTCAGtcGgATATTGAATTGTACAGTTtATTGCTG
TTATCTCAGTATaGgAaTGGTTTGCGGGTACAGGACCCATACTGAAAGGGACCATTTCGTCAAAACATGTGTTGTATACTGATAGAACAACAATCCcACC
GTCCTGCTCTTTCTCGAACACAACCTCAGGGGATCATGtCATGGGGCtCAaGTAGTGAGCCCGACGAATAAAAATTTAGACAGAGGCGtGTCTCTGCCTT
CGTGTGCCGCCCCTGCCATCCATATTTCCATTTTCCATCGCCCATCTCCACCTTCTGCCAGCTTCCACCTTCCAGTGTtCCATTTAGTGACTCTTGGAAT
GCATGGCACTGGTGTAACGGGCTGTTtCGCCCCCTAGAGAGACGTCTGGGgCTGAGCAACGGCGCATGTGGCATCGCATTCTGCCCCACGCTCTTCCGTG
ATCaCTGCAGTGGTTGACACGCCCATCGTGAACAGCGTGCTCGCACCAGCTGCCGGGCAGTGTGAGTCAGACTCGCGTGACTGTGGTCCTTTACTGGAAT
CAGTTGACTCGCACCAGGCAACCAaTCAACCAACCCCATGGGCTCACCTGCTCGCCGTtGCACTTCTCTTCTTCGGGgTGCTTCTTTGgaCGGGATCGCA
GCTTGATGTCaCGCCGTGTCCATTTCTTTTGCACATAGTGCATGCGCACGTtCcAACCCATGGTTGACTATGCTCACACCACTGAACGGATCAGCCCGCC
TCATGTATCTGCACATGACACCATGAGTGGGTCTTGGCTCGTGTTGAGCTCTTCGTACTGGTAGTATTATagTCGCcGTCTCATTTGCACTtcGTGATGC
GGTTCCACTTGGTTTGTGAGAGTTGAGAATCACCACTGACTGAAGCGGTTGTCAGATCTTTTTCGCTcgCGGTCGGCCCTTTGCGTTTGTAAGATAAGGA
CGCTGACGACCTGCTATCGGTTCAGGACGCTAGCGTATTGAGCAGGGCAGCCCGCCAGTCGTAGCTGGTCGTGATGCAGCTGCCATTCGCTGGTTTAGTA
ACGGTCCTCGGGCCAGCAGGAGCCTGATAGTCGACGACGAGGGCGAACAAcTGCAAATACATAAGCAGGCGTCGCCCCCcTCAAGTGGTGGACGCAGAAA
CACGCAGCTTGCAAATGCGAAGCTCCAAGGCCACCATGCCGACCAACCATCGAGTCGCCCTACCAGTACAACGATGTGACCAAAAGCAAAGCGAAATCTT
CGCGGGCATAGAACAAATCCACTGGACCAGAAGCTTGAACATGGCACGCCCCAAGAATGACCGCACAGTACCCAATGCGATGACGTGACAAACGTCCGGC
ATACGCAAGGCACGAGTGGCCATGGCGACTCGTAATGATAAGCATCCAAGGgAAAGCCAAAAaCGAAGTCGAAGTTTTtCATAGAGATCACGTCTCGCTC
GCTTTTGCAACGCCAATtATCTTtACTGTGTATGGTGCGACAGTCGCACGCCACCCAGCTTACTTTtACGTGCCTCCGCGAATTCAAGTACTGAGTATGC
GCACAAAAGTGGAGTCGGGAGTCCGCCGTTGTT