Description :
From Genome Similarity Track
Location :
scaffold_367:5295- 7254
Transcript NameFunction/comments
g7708.t1 THO complex subunit, putative

Sequence
1959 bases(100 bases per row)
CCTTACGCCTTACGCAGGATTGCTATGACGAAATTGCTTTGTCCGACAAGTTTCCGACAAGTTCGTGTATGGGGCCTGGAAACGATGCGTCCATTGGTCC
ATCAGAGCACTCGTCACACGGAGCCCATTTCGAGCATTACACTGCGTGTGCCAACTCGGTGGCTGCTACCGGTGCGAATTTAATAGGAATGGAAGTCTCG
ATCTCCACCACTACTGCGAAATACAACGACTTCGTTTCAACTAAACCGCCGTTCCTGACAATCGTTTTGCTGCGAATGATGTTGCAGTGAAGGTGCTTCC
TTCTTCTGCATCATCGAGCAGAAGTTTTCGCTTGTCAAGCACCGCCGATCGAAGGTGGTTAATCGATCGAACCAAAGTTGAAGTGCTCAATTACTGTACA
TTCATTCCCTACTAATTTCATGTGCCATTCATGTGTCAGACCGCCACTCCAAATTCCGATCGAGCCCAGCACCACTGCAAAAATGGCGCTGCATCTGGCC
AAGACGGCTGAGGTCCGTCGTCACCTCTCCCTCTTCTCTCTGCTTAACCTGCATGCCATTTTAACACGTTGCTCACCCTTTAGACCTCGATCAGCGACTT
CTTCGCGCATGACGATGCGCTGTCGCGTCTGGATCGGCTGCACCGCCAAACGCTGAAGGCGGTGGAGCACGAGCTCAAGGCCCCACGACCACAGGAGTTC
ACGCATAATGTGCTGGATCTGGCAGTGCAGAAAGTGGTCGAGAAACTGTCTTGGAAGCTCATTACGGAGGCCCACGCGACTCCCAGCAGTGTGGGCGTCC
CAGCGCTTCTGGACTTGTGCATCGCCGGTGTGACCAGTGGTTTCTTGGTTAATAGTACGCCGTACAAAGTGCTAGAGGACTTAATGGAAGGCCAGACGAT
CAATACGTGTGAGAAGATCTGGGAACTGCTGGAATCCCGCAAGGACAAGCTCACGACGGTGCGTCTGGGGTGTTTTACGTTGATTATCTGTTGGAGGAAT
AACGTGATGTATGTGATTAAATGAGCAGCCGGCTTTCATCGCCGAGAAGGGCCGTACCACGAAGGCGTCGCTGTGTTTGCTTCGTATGTGCAATGCGCTG
CTGCGCCGCTTGTCTAAGACGCACAATAGCGTGTTCTGCGGCAAGATCTTGGTGTTCCTGTCGTTCACGTTCGCGCTGTCGGAGCGGTCAGCAGTTAATC
TGACGGGCAAAGCCAATGTGACCAATATGACGGTGTTCGAAGATGAAGATGCGTTCGACCTGGCGGAGGCAGCGGATATCTCCAAGGCTTCTGATGCTGT
GTCTGGGCTTGAGGTAAGTGCCGTTTATACTCGCTTTCCTGAATGCTGAAGCCATTCTCATGTTATGTGGTATTTGTATCGTATAGATTGACAGTGATCC
AAGTACCGACGTTGGTCCGATCGATTACAACCTCTATCGTACCTTTTGGGACCTCCAGAGCTTCTTTCGGGAGCATCAAATGGCCACGCAGTCAGCGGAA
AACTGGGAGAAGTTTGTACGTATAGTGGAGCGCTGTTGTTTGTTTTGTATGGCCGTGTGATTAACCATGCCACTGATTTGTGATGTTGCATGCAGTTCAC
CGAACTGAATGTAGTGCTTGCAGCATTTGAAGGCAACGCGTTTTCACCGGATGACCTGGAGCGTTCCCGGGACTTGAGTGGTGGGTCTATCCAGCCATCG
GATGTTACCATGCAGGAGCCAGATAGTGACTCCGCCAAGGGCTCATCAGAGCAAGGCTCCCAAGAGCATTTTTTCCAGCCTAAGTACCTGACAAACAGTC
GACTCTTCCGACTGCAGCTTCGTGACCCAATTCTGCGGGAATGCATGCTGACACAGTTTCTCATTCTATTCAACGACCTAACGAAGGTAAAGCCGCCTGC
CGGATGCACCACTCCAAAGGCTAAGCTTGCCGACTTGACGGAACGTGTAGTTGCGTTGC