Description :
From Genome Similarity Track
Location :
Scaffold_606:5294- 10429
Transcript NameFunction/comments
Phypl_g9751hypothetical protein

Sequence
5135 bases(100 bases per row)
CGTCtgcacgaggacgacgtctCCAATCGCTcacacctgctgctcgacgctccagcaccacgccgcAATCGCCACGCCACCTTCGCCCCCACAATCGGCT
CCAGAGTGATCGCTGCACAACATCACCACGGATTAGTAGGAAAGTGACAAGAGGAGGGCACACCGGCGTCAATGCGCAACGGCACcaatgcccccccccc
cagacGCGCCGGTGACCACACCAACCTTACCGCTGTGGCAACCGCCACCTAGCCGCTCCACTGCGGCCAAAGTTCGCCCAAAGTTCGATATTACGTGTCG
CTAAGTACGGTCCTGACTGCGTCCTGCAAAATCCGTTCAAGAGTCGTTTTGGCACGGCCGACACTAAAATAGGAGATACCGCGTAGAGCTTCTCAGAGTG
TATCATTGACATTTCTGAGCTTCCGGCGGCGCACAACTTTGTTGATAGTAAGATACAAGGTTCAGGTATTAGATCAAAATGTAATCGACCTAGTATCACC
ATCCTTACAGATGCGCGATATAGATTGTCGTCAAAACGTAGGCGATATCAATGACATGGGACTTCTCGCACGCACCCGACTCGACCCATGTCATGTACTT
TCGGCCTCGCAAACCCATCGAGACGATGCAGCGCCTAACCACTGCGATACACCAGCTATCAAGTTCGCCACGCCGTATCGTTGACCTATACAGTCGCCCA
CGTGCGTCAGCGAGCAATGCTTCAAACGTCACCGCTGCCGGCAGGGGTCGCACGAACTTGATGCCTCGGCCAAGCCACGTCCCGACAAACAGAACTGTCA
ACCAGGCATGCGGCAGCGTTGGGACTCAGGGACGGCATGTGGAGCAGTGTGGGGCGACGCGCATACGACAAACGCTTGGACAGAGAGCCATACACaagag
gagaagcagcaaaaagAGCAAAAGATGTTCCCACACCGGGACTCGAACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGA
AGGCTGTATACTCCAACCACACACAAAATCACAACGCAGCACTACCACACACTCATACAGCCGCTGCAACCACGCGCCGACCACGCTGCTCCACGCATCA
CATCAACGCTTCTCTCACGGATTCGATCCTCGCATCAACTCCGACTTCTCGCACGCACCCGACTCGACCCATGTCATGTACTTTCGGCCTCGCAAACCCA
TCGAGACGATGCAGCGCCTAACCACTGCGATACACCAGCTATCAAGTTCGCCACGCCGTATCGTTGACCTATACAGTCGCCCACGTGCGTCAGCGAGCAA
TGCTTCAAACGTCACCGCTGCCGGCAGGGGTCGCACGAACTTGATGCCTCGGCCAAGCCACGTCCCGACAAACAGAACTGTCAACCAGGCATGCGGCAGC
GTTGGGACTCAGGGACGGCATGTGGAGCAGTGTGGGGCGACGCGCATACGACAAACGCTTGGACAGAGAGCCATACACaagaggagaagcagcaaaaagA
GCAAAAGATGTTCCCACACCGGGACTCGAACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCATAGTTTTTATTTAGTTTGTTAAATACTTAAAAA
GTGTTTCCCGCAGTTAAATGCGTGTAAAATACGATTTAATACGGGTTAAATATTTCAGACGTGAAAGCAAAAGCGGCAATCATTTATGTGAGAACAGTGC
TTTTTTTACGATGATGCGCAGAATGAAAAGAAGACCATGCTGGCCTATCAAGCTGTCCGTCGAGCCCGGCGACAAGCCGCAGACCAAGGTGCAGTTCAAT
GGCGAGGCCAAGGCGCTCCAAAATCAGAGgagatctcgtccatggtgctGATCAAAACccgcgaggaggccgaggccgtcATTGACGAGGGAGTTAAGAA
CGCCGTCATCAGCACCGTCAGGCGCCAAGGACGCCGCCATAGCGTACGGCCTGGACCAGAATGGTGGCGAGCGCAACGTTCTGATTTTCAACCTGGGTAG
GTTGATGATGTGATGGTTGCATCCAATCAGCTATTCTAATTCGCAGCTGCCACGGCTGAAGTAAACTCTGCTTCACTATAGTTACACAGATCAAGACTAG
CATCATGGCGCCAGGACTCATTCGCATGGACTCACAAGGACATGATGACGGCTGTTTACGCCAAGTGCACAAGCAACAGGAACAACTCCCCATGGACTGC
CACGATGGAATGTGGGAGCGACGCGGGTTGCTACCCGCGGACAAGAGTACATAGCTCACTTTACAACTTGCTTTGTGATCAACAATACATGTTGGGCTTT
GCCGGGAGTTCCAGCTTCCAAGCTTCGTTGTTTAACATCACGAAGTTAACTTTAGCGAAACATGTTAACGATGGAAACTCGCAGTGGACGTCCAAGCCGT
GTAAAAAAAACTTGAAGAGGTGAAGCGACCATTGCGACGACGGACTCAGGCAGCTTGATGGCTGCTACCGAGACCACGCCACTGAGTGCAATTCTGATGA
CGTCAATTCTGGTAACGTAGGATGAAGTTGATGCCCACTGTAGCGGTACGGAGACGACAGGTCCAAAGCGTTACCGATCGTCAAGAATTCGTTCGACAGC
CGCCTTCTGCAGTGGCTGTGCAAGTTCGAGTGGGGAACGAGTGTTGAGGCTGTGACGGATGACCGGATTGTCCGTGAGCTTGATAAAGTCGTGGGAAACG
TGATGAATGATGCGATTGTTGACATCGATTTGCTCTTCAAACGTGGATTGAGGATGAATTTGCAGGAGCAGGGCGTCAAAGCTCGTGTTGTGAGATATTT
CATCAGGTGCGATGCGATATTCTTGCAGCATGATCTCCAACGCACTTTCTTTACTGTGACCGGGATGAAGGAGAAGTGTAAACTCCTGaagcagcatctt
gagccCACGGCTCTGCGCGATGCAATTGACTCGCATCAGCGCATTGTTGACTCAGCGTCGAAGTCTAACAAGCAACTACTGTATCTTctcgtgaaggaga
aggctcTGGAGCAAGAGAAGGTATTCAAGCTGCTGTCTAAACGGAAGCAGCAGTCTACCGATACAAGCAAAACGCTCAACCGATATCAAGATAAGAGGCA
GCGCTTTGGTAGTGCCCGTGCCAATCCTGGGAAAGCTGCCCGCGGCGAATTTTACCACTGTCGCGTCGTGACGACCACGAAggctgtggctgcagcaaTT
TTACCCACAGCGAGCAGTAAATCACGGACAGGATGCTTTCACTGTAGTAAGGGACACTGGATCAGTCAATGCCCCTACCTGGATGGGGCCAGGAAGGAGG
CACTGCCTGCCGAGCACAAGGCAAAAACGGACAGGGGGTAATGCAGGGAAGCGATTCCGCGCCAAACGTGTCGAGTCTGTCGCGaccgacgacgatgaag
tgcgCCCGGCCCTCATACTCAAGGGTGTTGTCGAACTACCGTAATATGCCGATAGTGGTTCGAATTTCAACATAATCTCACGGCGTCATGCTGACGAACT
CTGTCAAGTGGACGATGCTGTTCGTACCGTGGAGCTTAGTGAGCCGATTGAATCGCGAGCTGTTGGAGGAACGGTGCTTACATCGACGCACGCAGTTTAT
GTTAACCTGACGTTGACCACCGCAGCTGGGCCAGTAACGTGTCAGGATTAGAAGCTGTGTCTCATCGTTGAGGCAGACGAAAACGAATTTTAGGTGAACA
ATGTGCTGTTGTTTGAACTAGGGATCGATGATGACCGACAGCTCGAGTATTCGGCGTCACGtagtgacgacgatgaaaCGTTTGATGACACGGGAGACAT
GCCGACCCTCACCCGGTTGCTGTCGGAGTTGTGATTGGTGGATGCTTTGGTCCTCGAAGCAATTGATCGAGGTGTTGTCAACAACTACATCACCAGCAGA
CTCTACACGATCCTACATCAGTTCAGTGGTTGGCGATTAGAGTTGGGAAATAGCCCGCCAGCCCGTGTACCCCCGCTTAAGATCAGGTTGAAGCCAAATG
CGTCTCCATACAGGTGTTAAGTGCGTCAGTATAGCCCAGAGAAGTCTGCTTTCATGGGCGCATTCAACAAAAAGTTGGTTGAATTGGGGTGGGTGAACGG
GAACCGCGAGAGTAGGTGGTGCTGCCCCACTCTCCCAGTGAAGAAGCCAAGTACAGGCGAATACCGGCAAACGGTTGATTATCGCCCAACGAACGCCATC
ACCGAGCCAATTCCAAATGTCTTGCCGAGCATTGAGGTAGCTCTGGAGCACTGTCGTGGCGAAATGCATACGCGATGTTCGACTTTCTGAAGGGTTTCTG
GCAGCTCCCACTGCGGACGCTGTTGCTATCACCGAATTTAGACGGACATTATTTGACGAATTACCGGATTATTAACACCAGCTAGAGCGCATGTTACCCA
CCAACTATTGTACTGGCAGAAAATGTTGGGGCTAGCTCATCCCGACAGAAATACCCTCTCGTGATGAAGGGCCGTAGCTCTACCGTTCTAGCGCCGATCA
GAGCGTGAAGCACCGCAATATAATGCGGGAGTTTCCTAGCTCCTCCTCACCAGAAGTAGCGCCCCCCACCTCTTACAACGAAACCAGCACCATGCAGTGA
AGACACTAGCTCACCCCTGAAGAGAAAACCCTAGTTGTCAACGTCTACGATTACTTCGTCAAAGAAGCAAAAGCAGGCCGAAGTGGAGGTCGAGACTCGC
ACCATCGTACTCGTGAGGCAACTACCTTTGGAAAGAACACAATCTTTCGAGTACTTCGGGCCCGCAACGTCGATCCAAACACCAATTTCGTCGAGGTACG
CCTGCCATTTTTGCCTATCCTATGATAGTGTGATATCAACTGTTATCTTATAAACTTGTATTTTACTAGTAGACTGCACCATCCACGCGCGGTCGCAAGA
ATCTCTACAATGAGATCGACCTTAACGTAGTTGTTCGTGAGTACGTTGCAGCGCAGAATAAAGCTACCAAGCCGATCACATCTCAACTCATTTGCAACTA
CGTAGAGGACGATCTCGGAAAGCGCTACAATGCGCGCACTATGCGGATATGGCTGAATGACATGGGATTTAGACATTTGCGATGACAGAGTCGTCACTAC
CTAGCAGAGACCACAGGCGACGTGGCATTTCGAGC