Description :
From Genome Similarity Track
Location :
Scaffold_1351:5292- 6835
Sequence
1543 bases(100 bases per row)
ACAGATGCCGATAAATGGTGCATTCCATTTGAGCTAAGTCTCCGGGACGGAGCCATTCATTGGTTCCGTCAGCTTCCGAAGAAGACGAAGCGCAAGTGGA
AGCTGCTGAGCGATGCGTTCATCCGCTACTACTGCTCGCAGTTCACGCAGACGGCACTGTCGCGTTACTACTCCGCCAAGCGGGAACGAAATGAACATCT
GTGCGACTACATAAACAGGCTGAACGGCTACGCTCGGACCGCCCGTCTACACTTTGAGAAGAGTGGTCGCGACGCGAAAGAACACGTACAGCAGTTCCTG
GCAACATGCGACGATGACAAACTAGCGGAGAGTCTCTACCACGCTCGAGTCGCCGACATTCACGAGCTCGAGGAGATCGTCGAAGATGTTCTCAAGGGCA
AGGAGAGAATGGCCAAGCGTGACAGTGAGTACCGATACTCTAAGAGTCGTGATACGCGACGCGACGATGGGTACGCCCGCAACAACCGGCGTGATGACCG
TCGCCGCGATGACAACCGCAACAAACCAAGAGTGACACTCATTGAAGCTACGGTGGACGACCTACTAGCTGAATTAGAAGGTCGTGAAGCTGCTCAAGGA
GGCAACGAGTATTCAAACGAAGATCCGAACGCTTACGACAATGTCCAAGATGAGTGCAACGACTTTCAGCCCGATAATACGGATGGCGATTTCTCATTGG
ATGAAAACGACCGATACCTCGCTGCTGCTAACGAAATCGAGCGCCGTGCAGCTGCTGAAGGCACCTACGCACGTTCGGACAACCGTCAACCGCGTGGAAA
CACGCCTGATCGCGAGAATGGCTTCAATCAAGATCGCCGAAGTAGTGACCGTGGGTTCAATCAGGACCAACGCGGTCGACGTGACTTCAACCGCGACAAC
CGACGCCCACAGTACGGACCATGCGCGGTGTGCGGTGGCATGAGTCACTCCGCCCACTACTGTAACAAGCGATGCAAGTTCTGCAAGCAGCTCCACGATG
CTGGACAATGCGAACTTTTCCGCAACTTCCAAGACCTTGCCAAATTCGTGCGCACCAAAGGCACGAAGGAGGAACTCCCGCCAGAGCTCAAGGCCGTCGT
TCAAGAACGTCATTTAAACTAGGCAGCCCGCCAACTACAACTGGGTTGGTCCCTATCGGGCTACCACAGTTAACCGAGCCTTCAATGGAAGCAGAGTGTA
TCTTTGCTTTCATGGGGTAGAGTGAATGGCCTGATAAATACGTAACAAGTGTGAATGCGACGGAAAATGAAAAGGAGAGGAGTAGAATCCTCGGTGGAGG
TGTTGGAGAAATAGTGGAGTGTGCTGATGCTGATGAGGGCACCAGCGAGGGTTCGCTCGGCTTGGTTTCGAGTGCAGCGCGAGACGAGCCCAAGGGTCAC
TCCAAGATGATGAAGTTGAACCCTGGCGAGAGACAGGGGTGGTGGTCGGCCAAGAAATTCGACCGACGGATCAGAATGAGAGCTCTGGTGCAAGGCGCTG
TGAACGACCAGCGAACGAGGATTCTCCTCGACACAGGAGCGAA