Description :
From Genome Similarity Track
Location :
scaffold_12:529196- 532781
Transcript NameFunction/comments
Plaha_PHALS_13280nadph-dependent diflavin

Sequence
3585 bases(100 bases per row)
GATGGCACCTTTGATGCATGTGATACCGCGACTTCTTATACTTTACGGCAGTGAAACGGGCAATGCACAGGATGTAGCTGAGTTCATTCAACAACGTGCA
TTGAATCGACATTTTGTAGATACGCAAAGTTTGGCAATGGATGAGTTTCCTGTGGCCGATATGCTTCCACAATGTTCGACTGTCGTCTTTGTTGTATCTA
CAACTGGAGATGGAGAAGCTCCTGAGAATATGCGTATGAGTTGGCGATTTTTATTACGTAAGACATTAGGATCACAATGGCTGGCTAATGTACACATTGC
AGTCTTTGGTCTTGGTGATTCTAGTTATGCAAAGTATAATGCAGTAGCTAGACGATTACAAGCGCGTCTTGTACAGCTCGGGGCAATTGAAATTATTGAA
CGAGGTCTTGGTGATGATCAGCATGTTTATGGCTACTTTGGTGTCTTAACTCCGTGGCTTGAAAGACTCTGGACAGCACTTTTAAGACTATATCGAATGC
CAGAGAATATGGTTGttgatgactcgccaaaaCCAATGCAACCTCATTATTCTATCATTGAACACGGAAGAGAATGTAGTGAAATGCAAGAAATAGCATG
TTTGACGCCAAAAATGGATCAATCAAACTTTTATGATCCACCACGTACCACAATTGGACGTGAGAAGGGTATAATCTGGGCTTCGCTTATGGTGAATGAG
CGAATTACCGCTGAAAACTGGGAACAGGATGTAAGGCATTTGGAATTTCAAGTCACTGATGACTTGAGATCAAATGATGAAGCTATTTCGTCATTTAGAG
CTGGAGACGTTGCAGTTATGTACCCTGAAAATGTAATTGGTGTAGACGATATGCTGCAGTATGTGAAAATGGATGGTGATACTGTGATTTCAATCAATGC
TGCTGATGGCTCAAAACAGTTTGATTTTCCTTCGCCGACTACGATTCGAGACTTATTTACGAAATATTTAGCGATTCTCGAGACACCACGTCGAAGTTTC
TTTGAAAAATTATCTCTTTATGCAGTtaatgaagaagaagtgaGGATCTCTTGTGCTGATTTTTTAGAGTCGATTTACTTACGATTTATGTATTTTTGCC
TCTGTAGAAAGAAAAGCTCGAGGAATTAGCATCAGCCGAGGGTGTCGACTTGCTATATGACTATTGTATTCGTGAGAAGAAGACGTACGCAGAAGTTTTA
ATTGATTTTCCAAGCGTGAACGTTCCGTTGACGATTCTAATGCAGCTGATTCCCCGTCAACAACCGCGATCATACTCAATCTCATCATCGTCTTTACTAC
ACCCAGGACGCGTAAGTATTCGGTCCCTTAAAAAGGCTCTTTTCTTCAGCTGTAGCTCTTCTAATCTCATATATCCCACCAGGTGCACTTGACTGTGGCA
ATTGTAGATTTCTTGACACCATACAAACGACGTCGCCTTGGTATCTGCTCGTCCTTCTTCAAGTCATTAGATCCATCAATAGAGAAAAAGCGTGTGCCAA
TGTGGATTAAAAGAGGCGTCTTTACACCGCCAAGCTTAAAGCACGACTTGTTACTAATCGGTCCTGGTACTGGACTTGCCAGCATGCGAGCCGTAATACA
AGAGCGTCACGTTTTGCGTAAAGAAGGCCACGATGATTGTATTGGAGCCACGTACCTTTACTTTGGATGTCGCCATGAAAACAAGGTCAAAAATTTAAGG
CTTTGAAAGTGACATGTCTATCATGCAATAATTATTTTTGTTGTTTTTAACAGGACTTCCTGTATCGAGATGAACTCCGTGGGTTTGTGTTAACTGGTGA
TCTTACTGAGCTGCACACCGCGTTCTCACGTGATCAGGTACGCATCGATTTGTATCGATATTGTTTGTTTGATCAAACtttaaatatattttatcAGGAT
CATAAAATCTACGTGCAGACACGtctagcagagcaaaaaGAGACAATTTTTGACTTTTTGATGAAGAGCAATGGATGTATTTACATTGCTGGATCTGCTA
AACGAATGCCTACGGATGTGTACGAAGTATTACGTGATATTCTTCGTTCAGTAGGAAAAATGTCTCTTGGAGACGCTGAGAAGATCATGAAGACGTTGGT
TCGCAATAAGCGCTATGTCGTAGAAGCCTGGTCGTaaaattattgcaatatCACAGTAGATTTCTGAAAATTCGTTTTGTCGTATAATCCTCTATGTAAT
TAGTCTAAAAATGAATGATGCAAACATATTGGAGCTGGAGCAGCATGTGCGTACATTTGTGAAGCTCACGAATCTCACACAGACATTGCAATTGCACGAA
TGGAACATTGAATCGCTTCAAAGAGCGTTGGAATGGTCGTGTTTAGCTGAAGATGTGGCAAATATAAATGACACTCAATTCGACGTCGAGAAGCATATTC
GTCAATGGTTTCCAGTCGCCACATTGCCCACGTTGCCTCTAGATAGCGTACTCACCATCGAATCTTTGCGTCTTGCGAGGTTTCATTTACTACGATCCAT
TTTGCAAAGTCCATTCTTAGCATCACATCCGACGCGATCGGAATTGGTGGTAGCAGTACTTCAGGAACTTCAAAATAGACGAGAAGATGCTTTGTATCCT
TCGACTGATGATATTGAAGAAGATTCACCTCATAGGTAGCATATTAATGGACCTATAGCGAGAATGTATTGACAATTGTGTGATTAGTGCGTTGCTTACT
GAAGCGATTGTTGGACCAAAGCGAACGAATGCTCTGCTCGCAATAGCAAGAAAATTAAGTGACAGTTGTAAGCGTGTGCGTGTACAAGGTATGACATACA
TTGTTTTGCTTGTTTATTGTATAAGGCATTAAATATCAAGGCTGGACTTGTTAAGTGCTTTCAGGGTGGGTTGAGATCCTTCCATTAAAAAGCTATGCAC
TTTTGCCACGTACGCTTTATCTCAAATCTATGGCAAAAACTTTGCAACGAAATGCTGTCGATGCTCGAGCTGCTATAAGCCCGAAAACGTATCAATGCTT
TTTAGAGGACCTTAGGGACTGTTTTAAGGCGCCGGATGGGAACGATGTTCGGGTATGTTCAACGTATTTAATTGTCTAAGATATTGCCTTATTTCGGGTT
ACTTCATTGCAGGAAGTTGTTGTGTTAATGCTGGTCATGTGCGATTGGCCAAAGGAAGAGCCTGTGCAGCTTGAAGGAATGGTGACTGACCTTGTAAACA
TTGTGAGTCAATGGGTCACGGAGAAGCCTATTCGATTTTGGACTTTCCACCCGTATTTAGCTGCCATGTTAGCAAGTAAAACAGAAGACCTTGTACGTGC
TTACGTCTCGGAGTTATTCACAACAGGACTATTGCAACCATGTACGAATTCATGATTCGAAAGGTGTTCATTGAGCATTGATAAACTTATTATGGTTCGT
AGGGGAACGCGAGTTCGTCGATCGGATCGCAACTCTTGTTTTACAACCGAAAGGTGTGGAGAATATCCTAAAGCCTGCGTTGTCAAAGCTCGATCCTCAT
TTACAACAAGTCTACTTCAATGTCGATTTGATGCAACACTCTTCATAAATATCACGAAGTTGGCTTGAGCGCAATAGATCGACCA