Description :
From Genome Similarity Track
Location :
Scaffold_105:52906- 55194
Transcript NameFunction/comments
Physo_141905hypothetical protein

Sequence
2288 bases(100 bases per row)
GAGATTTATGGAACTTTAGTAAAAATGTTGTACTTTTCTAGAAAAAGCTGACAGCTTGTTTGTGCGGTAGACACGTTCCAAATTTACTTGAAGTTTGTAA
AGTTTGTGAGGCATAAAACAATCTTCGAGCAATTGAAGTCGGAACGAGCACCCATGCCCCAGGAAGTGTCCCGCTTGCTCGTCGTGGAGCTGCTTTTCCG
TGCCAAGAGCGCCTTCGTCGACCTGTCACACGTCATCACCTCCGTCTCGCAGTTCCTGGACTCGTCGGTCGAGTTGCCGCTGCACAAGGCCTGCGCCTTC
GAGTCTCTGCGACTGCTGGAGCGCATCCGGGTCTCCACTCAAGCCTATCGCAAGCAAAAACGCGGCGGCAACGACTGGTCTCTTCGCAAACTCCTCCTAT
CCGACCGCTTCTACCGCCACTACCAGTTCAACCAGTCGCTGCAGGAGGTAGTGAAGCGTAAAGACTTCAACTTGGTCAAGTGGCTGTCCGCCCATTTCCA
GGGCGTTGCCATCGTGCCCCAAGTGGCGACCACAGCCGCCAGTGTCGGGGCCATGGAAATCTTGCAGTTTTTCCTTGATAACGACAATTCTTCGCATAGG
AGGCAGCTACAATCGACAAACCCCACCAAACAAATTGTCGTGGGGCATCGAGTTCAATGGAGCAAGGACGCCCTAGAGGTGGCGGTGCTACACGGCCATA
ACAACGTCATGTGGTGGCTATTGCAACACACCCCAAGCGTGAGATACGATAAGAGCAAGGCTTTTGAGTACGCTGTGAAGAACGGGGACATCGCCCTGGC
AGAGTGGCTACTGTCTCATGGTGCCGCCTTGCGGCTGCAGATCCAAGGGCGCCGTTTAGTGCACGAGGTTGCAGCTCAAGGCCGCCTTGATGTGCTCAGG
TGGCTGGAGAAGGAGGAACTGGTTTCGATTAGTTGCGGAGTGGTAATGGTGGCAGCGGAGAATGGACACTTGGATGTGGTGCGCTGGCTGCTGGATCTGA
ATGCCGGAAGAAGTGACAAACTGGGGGGAGAGGCCAGTCTGGCAATTCACACCGCGGCGGTGAACGGGCTTCTTGACCTCGCCAAGTACCTTCGAGCGCG
CGCGGAAACACCTCGAAATGCTTGCCAGTGTGCGGTGGAAAGTGAGGAGCAGGATGCTCTGATTCGAACTTTGACTACGCAGCGTGGTGAATCGTGCACG
GCTGCCAAGGTCTCGATCGATACGTTGATCAAAGCCGGGAAGAATGGCCATGCTGGTGTCGTGAAATGGCTATCAACGGAGTATTGTTCTGTTATCGCCG
ACGGATATCAGCAGACACCGACCGATGGAGCTCTGATGGATGGTATCGCTGCGCGAGGGCATCTGAACGTGTTAGTTCTGGTGCAGGCGATGGAATTTAA
CGCGGATAGTCGGAAACGCAACAGAAATGGATCGAGCAGGCCCGGTCGCAAGTGCACCAATAAGGCGATAGACTGTGCGGCGGCAAATGGGCATTTGGAT
GTCGCCAAGTGGCTCTTTCGGAACAGGCTGGAGGGCTGCACAAGTCGCGCGATGGATGGAGCTGCTTCAGGAGGCTTTTTGCGCGTGGTGCAATGGCTGC
ATGGAGAGTTATCGATATGGAGTACAAAAGCTGCAATGGACGGCGCTGCTACCAACGGACATCTTGAGGTTGTGAAATGGCTGCACGCCAATATGAACGC
TGGCTGCACGACACAAGCACTGAATGGAGCGGCAACAAATGGGCATCTTCACGTTGTGAAGTGGCTGCATAAATATCGCCGTGAAGGATGCACCGTCGCA
GCAATGGACGAAGCAGCAGCGAATGGTCATTTGGCGGTTGTGAAATGGCTGCACCGAAACCGAGCGGAAGGATGCACCACAGCGGCGATGGACCAGGCGG
CGCTACAGGGGCATTTCAGTGTTGTTCAATGGCTCCACACTCATCGCTCGGAAGGTTGCACAAGTTCTGCCATCAACAGTGCTGCCAATCGCGGGAATTT
CGAGCTCCTGCTGTTTTTGCACTCGCAATGCAAGCAACCTTGCACGACGGAAACTATGGAATTGGCAGCTCGCAACAAGGATACGGGGGGTTATGCCTGG
ATTCTCGACCGCTATCCCCAATTTCGTATTCCCCCACAGGTGTAGCGTGATCTATGAAAATGTTTTAAGTTCATGTACAGGTTCGCGTAATGGTTCGCGT
AAATGTGGACCGAATTTTGACTTTCGTTAAAAGGCAATGGAACCGACCAACAAGTGCTTTGCGTGCACGCCCTACGAAAAGACGATCA