Description :
From Genome Similarity Track
Location :
Scaffold_5:52904- 54905
Transcript NameFunction/comments
Phypl_g230myb-like DNA-binding protein, putative

Sequence
2001 bases(100 bases per row)
cacatggcgtcggcgcgaCCGCAAGGAAcctccgccgccaagcagccCCGGgcctccaagaagcgcaaggccagcagcgacgcgcccgccgccaccttcc
gcgcctccaccgccagcatggtctcggcgcgctgctcggtCTGCGGCTTCGGCGCGTCCACGCTGGATCACTTGCTGACTCACGTGCGCGAGTCGcacgg
ccgcggccacgagcaGGCGACGCCCCAGATGGGTACGTCCGGCTGGTTGAAGCCATCTTGGTCATCGGTGAAAGCTTTTGACTGACAGTCTCTCTGTacg
cagcgctgccgctcgaAGTGGCGCAGATGAtggtgcagcgcgcgctggaccaggcggcgctgggaggcgccacgagcgcgtggcTTGaggccatgcagca
gcagtacaaggcggcggcccagatgacggcggcgctggaccgGAGGGACCCGCACGGCGTCGCGGTCGTGATGCACAAGCTACACGGCATGACGCGGGCC
GGAGAcgagcagacgctgctcacgacgctgcaggaggccgcGCAGatgttgctgcagtcgccaccagctccgcaTCCATCGGCGGACGCCATGCCAGTCT
CGCCAGTGGCGATCAAGCTGGAGGCCCAAGCGCCCAATCCACCAGCAGCTACAGATAAcgcggcgccgtcgcagcagcgaaaGGGAAAGGATTCCAGCCT
CcacgaggcggaggcggcgcaggcgctgaCGGGACTGCGAGCCACAGCTTCGggtgcgacggcgacgatgacgataACGGCGCCGGTGATCACAACTTCG
TcctcgcggccgccggcTGTGCCGAAGCCGTCTCCCACGGCGCCTCAAGCCTCCTTCCCGTCCTTCGCGCTGGGATCACCGCTGACCATTACTGCGCCGC
AACCGCAGCTCGGCAGCCCGCACTACCAACCCCCGGAGCTATTCACCCCCGGTACTGCGCGGTCGCCTAGCACTCCGTCGTCACTGCCGAGTCTTTTTGC
GCGCAGGCTActggcgccgctggcgtCTCCATCCAGCGTGACGGACCCCGGGGACCGTCTGGCGCAAGGTGTGGCTGGATTGGGATACCAGAATCCTATG
ATCGTCACGGACCAACGCAACGCAATGGGCTCTACCATTCGACCGGATACTTCCCCTGCGTCGTTGACTCCCGTGTTCTACTCGACGCTGTCAACGGCTA
ACAACGGTGCTACGCCTACGAACCGACCAACCTCGGCCTCTCCTGTCAAACGCAAAAGTATCACCtcgaagcagctcagcgTAAGGTGCGACGCGgaagt
cgccgctgctcgtgcggcCGCATCCactgcggcggcagctgcagacacTACCGGGCTCCTGCCGCTGGGTCCTATCTCCGTGCCCggcacgcccagcacg
ccTGCGAGTCGAAAAGCTACCCCACGACGGTGGACcaaagacgaagatgacgcgCTGCGCTCCGCTGTGGAGAACCACCGCGAGAAGAACTGGAAGGCTA
TCGCTGCTCAAGTGCCTGGGCGGAACCACACGCAGTGTCTCCAGCGGTGGACCAAAGTGCTGGCTCCAGGGCTCGTGAAGGGCCACTGGTCTCCGCACGA
GGATGAACTGCTGCGGCGCCTTGTGGCAACGGAGCAGAAGAACTGGGGCGACGTGGCCTCCAGGATCCCGGGCCGCACGTCGAAGCAGTGCCGCGAGCGG
TGGCACAACCACCTGGACCCGCAGATCGTGCGCGGCGCGTACACGCCCGAGGAGGACCGGCTGATCctggaggcgcaggcgcGGCTGGGCAACCGCTGGT
CGGTCATTGCGGCGATGCTGCCTGGCCGGACCGAAGACGCCGTCAAGATCCGCTGGAAGTCGCACTGCCGCGTGTGGCGAGCGCGCAAGTACCTGCGGAA
GAACCCCAacagcgacgtggacatgCTGAGCGAGccggcgcagacgccgagAACGCCACTGGTGCCGCCCATGGGCCACTTCACGTGGccggtgccgctg
c