Description :
From Genome Similarity Track
Location :
Scaffold_260:529- 4276
Sequence
3747 bases(100 bases per row)
CACCAATACATCGTGATCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCATGGGCGTATCATGAACCTCATAGAGGATTCGATACTTAAGAT
TCTCATTATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTCGCGCGTAA
GCTTAGACAGTTCATTGTCAGAGTATTTAAACTCGTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAA
GTCAGGCACTGACGACGTCACTGTCGTGACATGAGCTAACTTGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTAC
TTCACCTCGAAGTTATACTCGGCAAAGAAGAAAAACCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCCGTGCGTAACGACGTATGATCAG
TAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAAAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTATT
CTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCAATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGCAAAGCACAACCGATTGCAAAATCGGAGACG
TCACAGACGACGCTAAACGGACCATCCGGGTCCGGTAGCGCAAGGATCAGAGCCTGGAGGAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTGATGCTCGT
CGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCGGATAATGGCCGAGCCATCTCCGCATAGTTCGCGCTGTACTTGTGCAAGTAATTGGCTAAGCC
TAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGTCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAG
CACCCGAGGAACGGTATCTCCACCGCGCCAAAGACGCACTTGTTTAAGTTGGCATACAACTTATTAGTGCGTATACACTCGAGCACCGCTCGCAAGTGGT
CAATGTTGTTATCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGCCGAATATATCGTCAAAGTACGTTTGAGCATACGCCCGGTGGGGCCTAAACAG
CGGCGTCACAAGACGATTAAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGGCATCACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGT
CAGCGGAACGTCGCTCGCTCTCATGAGCAATTGGTAGTACCCATCGACCAAGTCGAGCGCACTGTACAATGTACAGCCTACCATGTTGTTCTGCAGAACA
TCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAACGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGA
ACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGAACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGTCAA
AGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGTTCGTCGGTGGGTCTTTCGAG
ACAACGTCTCCATACTCTTTCATCACCGGGTAGAAGGGATCCGAAGGATCTTTTAGGATCGTCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCCT
CTAGGACCGCGTAGTCCACGACGGATGAGGAGTTCAACTCCTCCTCAGGTCCCAGTAGGACCACCTCGGCTAGTTTGCCTGCCTTTAAGGCTTCGCCAAA
CTCGGCAATGGACATCTCGTCCAGCTCTGGCAGAGCATCTGAAGCGGGCAGAGTGTCAAGGCTGATGTCGCCTTCTACCTCCCCCGTCACTCCGTTCACG
AGTGTATACAGCTGTTCACAGCAATCACGTGGAGCCTCACCGCTCGTCACGTTGGACACATCGTCCGACGTCGAAGACGTCACAGACGCCCTTCGTCTTC
TTCTCCTCTCCCTCCGCGACCGAGCCCGGCCGGATGAGGGCGGTGTGGCGACATCTCCATCACCATCACCGGGTGCAGCAGCACAATACCTCCTCGAAGA
GGATACAATGTCTTGCAAGACACTCGGCTGAAAGCCAAGAGGTCCTTGACCCTCACACAGTGAAATAGGTGTCACTTCACCTGCATCTCCTGGGCCACGC
CCATGATGCCTCGACTCGCAGTCGACCGCGACCCTCGGGTCACGCAGCGGTAGGTCATCGACCAGATTCGTACCACTCAGTTGGCTACGCGCCACTCCGC
GCTCGTCCTCACCAGGACCCAGCAGTTGGTCATTGACCTGACCTGCACCGCTCAGCGGATAGCGTGCCGCACCACGTACGCCTTAAGGACAAACAGCAAC
CTCGTTGCTAACAATTTCGGACATACCAATGTCCAGCACTACGGCCGCCTCGGCCTCGTGCTCGCGCCAAAAGCGCTTTTGCTTCCTAGCAGAGGTGGGT
TCATGACTCATCAAAGCTCCACTACGAGCAGGGTGCGACGCACCCAGCGTTTTCGACTTCTAGTCGATCCATGGCTCATGGCGTTCCAGCCATGCCATGC
CAAGGATGAGGTCATACCTCGCATCCAGGTCTAAGACCAAACAGCGTTCCACGCTATCGAAGTTCTCAAACTTCACACCAAGGTCGACAGAGACCTTCGA
CACAGTTACCAGTGTCCCCGTCGCGAGACGGGACAAAGATCGTATCTCTCGTTGGCACTTTCAGTGCTTTAGCATACAGCTGACTCCTTTCTAGGGTGGA
GCGACGGCGTAGTTGCCCGAGGCTCCCGAGTCAATCAAGACTCTCCATGAATTTGCAAAGCCCTTCACGTTCGCTTGAACGACCAGCAAGCTCGGCTTGC
ACACACTCTTCTCGTAAGAGAGCTCAGCTCTCTTCGGGGCTGAGCCCCGTTGCCCTCTACCTCTTCGAGGCACAACAGAGCTCAGTTCTTCCCCAGTAGG
CCGCCCCGCGCCTACTGGGAGTTGCCGTTTCCCGGCGATGACCCGGAGGGTTGGCTCGCCGGAGCCTCGCGCTTCTTGCGCAGAGGGCAATAGGCCCTCA
AGTGCTTAGTGCTATTGCACACGAAGCATCGGCGGATCCCGGCGCGCGGCTCCGCAGCAAGAAGCTCCGCATCATCATCTTCAGAATAGCTGAGGTCCAT
CGGCTCTGGACCGCTCGAAGAGCTTGCGCTACCAGCGCTCCAACCAGGTCGCGCCGACCTGAAGTTGTGATCGGCATTCAATGCCACATCCACCGCCTCT
TCGAAAGAGTTAGGGTGTACACGGAACACTTCCGTTCGAGCTGCGCTCACACGAAGTCCCTCCATGAACACGGTCACGCTGACCAGTTCCGGAAGAGGGT
CCGCCGCCATTCCGGCGATAAGAGTTCTCAACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAGCTTTGACCGGATGCGGTA
CGCCTGATTAGGCGGCGCGAACACGCGCGAAAGCTGTTGCTTCAACTGACCCCAAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTGCCTAT
TCGCGAGCGCGACCTCCAAGCCTGGCGATAGCCAGCGCCACGCGCTG