Description :
From Genome Similarity Track
Location :
Scaffold_204:529- 2202
Sequence
1673 bases(100 bases per row)
GTGAATTCCTGTTGGCGCTTTCGACGGCAGTGGGCTGAAGCGTCAGGAGCAGAGCAGAATAGGTCAAGGAGTGGCAGGATGGAGCAAGGAGCGGCAGGAC
GGAGCAAGGAGCGGCAGGACGGacgaaggagcaggacgGCAAGACAAGGCAGGAGGTAGCGGCACGCCACGGGTTAGTGAGGCAGCGGGCCGACCCGCTC
GCCGACTAAGACCCGGCCGCTGAGAAGATCGCAAGGAATTGAAGAGGCGCAGAGGAGAGCAGACCAAGACGATGGACTGATCGAAAGCCAAGTGGGACGG
CGAGGCGACATCGCGGCTGCAATGGACGGCTCTGACCGACTGTGAAGGGTCGGCGGTGAAcccagcgagcgcggcatTCATGTGTAGGGTAGAAATAGCA
GCTCACTCTAAGATTGGCAGTGCAGCACGCAGAGcacgaccaagacgctgaagcaCTAGGCATTAGTGCTCAGCTAAGACTAAgacaacaagcagcagct
gaagtAGCCGCACTGTGAAGTTCCTGGCGTGGCCCTCGAGTACCTAAGGAAGAACGGGTATCTGCAGCCCCGTGAGGTCGCCGGTATCAGCAGCCCGTGA
CGCAGGAGGGTAAATAGCCAAAGAGAGGGTAGTTTAGCCCCCGGTACTAAGAGCCCCCGGTGCAACCCTCCTGGCGAACCTCGGCGAGGTATCGAGTCAG
CCCGACCACCCTTGTACGTGCTACGGATAAGTCGATTGCCGGTCGTCGTGCATATTTCGTGTTAGGTCTATATCTAGGCGGCGACTGGTGTTCGTAGCCA
CCAGACACCGTCCTTGACCGAGGACAGGACTGGCGCACAGTGCAAGAACGGCTAGAACGGATCACTAACGACTATAAGGACAGAGCTTACTGTAACTACA
CAACTATACCGGGAAGTGACTGCCAGACGGCTTGGATATGTACATGCTTGGTTTGAAGACAATTTATGAAAACTACATGTAACAGCTCGAAGTTTTTTGT
TGCGGCGAGCTCGAACCCAACAGTGCAAAAGCTGGTTGACTCAGGAGCATATCCAGCGCGTAGGACACGGTTCCACCCGCGTTCGCCCTTGCTTCACGAA
TATCGGTGCAGTCAACGTCACGGAGGAAGCTCGTTGAAACTCTTTCTTTCAATCGTTGATGCACATTTCTGAGCTCCCCGCATTGACGGCACAGTTGCAT
CTTCAACGGCGGTCTTGGATACCATTTcaggaagacgagcagcagctaACTAGATGGCCGGCAGATGACTTGCTGCTCTCCATCGCTCGAACTTGCTTTG
ACAGCCATAAACCCTCGATCCCACCTACATAGGTATCGTGAACTAGATTCAAGCTTGGAAGGACAAGTATTTTGCCTGTATATGTATCATCAGCCTGAAA
CACTACGAGGCGTGCCGGCTTTCACCAAAGGTTTTAGGAGCTGATGCACTCGCAAAAATGTCTAGGACGGGATCACTGCACCGTAGCGGACTCTGTTGAT
GAATAGTGGCAGTCACTGCGGGTTGAAAGCCTACACTGCATCGGAAAAGCTCACccaaatggctacatctcGTCGCACGTTGCACCTGCCACCTTCGCGC
GACATCCGCTTCAAGCATCCGACACGTCATTCCGACAAGGCGCAGCGATACACCGAGCACTCGGCGTCACCTC