Description :
From Genome Similarity Track
Location :
Scaffold_269:529- 2009
Transcript NameFunction/comments
Phymu_g7812ABC transporter lipid exporter ABCA1 family

Sequence
1480 bases(100 bases per row)
GGCAAGTTTTGTCGTCGCACGAATGAATGGACTGTAACGTCGCACTAGATCTGATAGTCTTTTGGCGTTAGAACTGCGGATGcgagcgactggagcgaGA
GGTAATTGGCGGATTTCGCGCTGAGAGCGCTcgacctgctgcttgggcgtGGGGCGCCGGCGCTGCTTTGAGACGACTTGATGGGAAGCTCGTAACTTAC
AACGTAAGAGGTCCAGATATGCCCTGTGCCTGGCACTGATTGGCCAACGGTTTAGATAAAAAGTTATATCTAACCTACACATGTCTTATTAATCTACAAT
GTCGCACGAACGATGCAGGTTCTTTTGGGTAAATTAAAAACGTCCCCAATTATTCGTTTATTTTGGCtaaattaaaaaaaaatacattCACCAGCCAATA
AATAATATTTAAAACAAATTGCTTGGTAAAGATCGGTCTTGGTGActgagctcaagaagaaagtcGAACCTGATCACAGTATGCGCAATACTTGGTGCAG
TGGATGCCCATATATGCTGACATGTATGCGTTGATTCGCCTACAACGATTGGGTTAGCAAATTCGACGATGCTTGTTGATCCTCTTAAATTTGtattttt
aaatattttaAAAATATGATGTCTCCTTTCCTTTGCGTTACTCTGACTTTGTGGATATGTACCTGGTATGTATACATCTGCTTCAATCTGTTCGATTGCA
GACACGTCATCACTCATGAGGCAGCCCCGCATGGTGCTGCTCTCACGACTTCCAGGACAAATGTGTCTCCCTCCGTCACAGATTACCACTTGAGGGCGTT
CGCGTGGATTACCCCATAAAATCCACATCGCGGCAAACCCTCTTTTATGTCCACCCATACTCAAACGCAGTCAACACCAGTGATAATCGTTTCGTGCACA
GTGATTGCCATTTTGCTGCATTGAAACAGTCGACTGGCACTATGCTCATTCCGCAATTTGACATCTCGAGCGCACGTACCACGCTGTAGCAGCCACACGC
CAACCATTTCGACTGTTTCCGACGTTAACACAGTCAAATCGCACCGCGATATGGCGCCAGACAAGGGCAAAGCCAACGTGGCCAAACTCTCCGAAAGACG
CACAGCCTGGACGTTCGTCCGCGCTTTGCTATGGAAGAACTGGCTGATCAAGCGTCGTCACCCAGTGGCCACCGCCTGCGAAGTCATGGTGCCCGTCCTG
TTCATCATCCTACTGGGAGTTCTCAAGAGCACAACGACAACCGTCGCAGTCCCGTCCGGTTGGAGCGacacctcgtcctccacgggCGACGCAGCGCTTG
GAACCAGCTACAACCTGTTCCAACCCACGGGCCAAACCATCGAGTGGGTGAGTGCCGACCTGCCCAAGTTCGCTCTGCACGAATCTTCCATGACCGGACT
GCTCCTGAAGCTCGGGGTGCAGtcggtggacgacgccatccGTCTCGAGGAGCTGTCAGCAGCTGACCAGGCCACGTGTT