Description :
From Genome Similarity Track
Location :
Scaffold_60:52897- 54168
Transcript NameFunction/comments
Aphas_H257_14818Hypothetical protein

Sequence
1271 bases(100 bases per row)
AGGGCTATACTTGATGATCCAGGAAGCCAATTATTCGGTCGCCAGTGTCAAGCGCATCTTAGCCAAGAAGCGTCCACTGAGTATGCTCGAGCTGCATCAA
GTCATCTCGGGATTCTACCAAACCAAGATGAGTCAAGACATTGCCGACGACAACATGCACCGCCATCGCGAAGGTACTAGCTATATCGAGATACTATATA
TATATATTTCCCGATTTTCTGATATTCTAGTGATCTTTTGAATTCATGAATGTAGGGCTAGCACAAATGTTGTTGGATTCGTACACTGTGTACTATGGGC
TACGGGAGCTCGCTATGGGCCAACTCATTACCCTCGACTCGGCGATTCGAAAACACGCTGCGGTACTAAACCTTGAAATCTGTAGCAAAATATTTTCGCC
AAACATAAATATTTTTTTGATGGTCATATATATACATATATATCGTAGAAAAGCGCGCGCATTCGATTGTTTGGGCTGCTCGTGGGGTCGCTTGAGCCGG
GTAGTTATGCATCGTCGGCGGCGGCGATTGATTTCCTGTTATTTGTCGTGGGGGTGTTGTTCAATGGTGCGTTCATTCGTGCAGTAGTTGCTTCAGAACA
TAATCGTATCTCAAATTGTAGTGGGCAACTACCGAATGCATGAAGAAAGAGCGCAAACGAATGCCAAGCAGTTGAAATCGTGGTTTGGAGATGGCATGAC
GGGCAGTCCCAACTGCACGACTATACCCCTCGGTCAGTCTTCTTGTGACAATATATATTTTTGTCCCGTATATGTGTATATATATATTTACGTATACCTT
GTGATATTTTGATAGACAAGTTGATCCAGACGGTTCAAATCGTGTTTGCACACAGCCACGTTACGATCAAATTTATGCAAGACCTGTGCCACTCGCAAAA
CGAGCACGGCGAAGTCGAGCTCGATGTGGCGTTAGAGTCTATCGTGTATTACTGGCTCAAACTATATGCCGAACAGATTGTCACCATGCACAACGTGTTT
CAGCTGGGCGACAAGGACACGAACGGTGTGTTGGACTTCGCCGAATTCAGGTGCAAAATTGCTTGGTTGCTAGGCCACTTTCTGACGAATAGGGGAAATC
CCATTGGTATAGTGACGTGGTGCATCACTTGGACCCAGACATGACCCGACGAGACTGCTTGGATCTGTACAACCGCGTAGCTGGGGCAGACAACGTGATT
GACAAGGAGGAGTTTGTCATGGGCATGATTTTGCACCAGCGGGACATCGGCCTCAAGTCGTACTTCGCTGC