Description :
From Genome Similarity Track
Location :
Scaffold_342:52882- 58258
Sequence
5376 bases(100 bases per row)
TAACTTACAGTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAAATAAAGAGGGGACCTGTGAACTACCGTTCACTGAG
AGTTTGTATTCTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCAAGCCACCGCGGGTA
GACTACCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATC
TTCGGGATGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCATACGAGCAGGGCCTCATCGCGC
ATGTGCGAGAGTACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGA
GAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCCTTTGCACTCTCCAACCTTAGC
GGTCGTGCTAAGAGTTGGGTGTACAGACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCCGAGCCGCGTTCCTCCCGGCGAACT
ACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGTGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGT
GGGAAACCCACTCAACGAACATATCAAGATGACAGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACC
CTTGAAGAGGCGATTTAAGTGGCTCGTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGTTCCTTGTCGGCTCCCG
GACGAACAAGCCCCAACGGACCCGTTCTTATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCG
CGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGAGTCGCTGGCAGAAGCCAGGGTCCCGGGGACAGGGGAACGCCGGG
AACCAGTAGGGGCGGGGCGCCCTACTAGGGAAGAACTAAGTCTTCGTGATGGGTACGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCG
CACTCTCGAATCGGCAAAGTGCAGCGGCGGGCTGCTCATAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCG
TCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGTTGTCCGATGCTTTGAGAGATAGCAAGGGCAACGAGACGGTGTCAGTGCGAC
TGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGACTCGGTCGATAGCGTGGCACTCAATGCACAGGATCAGTCCAGCGACAAGACTTAAACCGA
GTCCGTTCCAAATCAGACTTGCTCGCAACAGCAACAATTTGTCCGATGTTTTGAGAGAAAGCAAGAGCAACGGGACGGTGTCAGTTCGGCTGGCCGACGG
GAAGGTCGTCACTGTCCCCAACGTACAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACTGTTCTCGATATGGATTCATAT
GATATGATCCTGGGTATGCCCTGGCTTCAAAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAATCCGACAGAG
CATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGT
ATATGACGACTCTGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCTAAGTGGGTAACTTAGGTCCACAGGCAGCTGCAGCTGTCACGAAC
ACTGAAAACAGCGTGTTTAGAGCGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGACGAAGACGTCGGATACGCTTCCTGCGTGGGTA
ACACAGTGCCACACGCGGTCACCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACGGTACCACACGAGGCCACGAGTGC
CTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAAGCTCGATGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCG
AACTTCGCTCCGATCGACGTCGCTTCAAGCGACTCGGAGGCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTGTCACATCTTCGATGGCG
AGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGAAAATGACGGCTGAGTCTTTCCT
GACCAACCTCAAGGCTGGAGAGATTGCTGAGATGGCACTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACGCCTCCTCTGTCTTGGACGAGAACGTC
CAGGAAGACCTGAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACG
TGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAACTTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGG
CCTCTCCCGCGCGAACAGTGCGAGATCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGA
CTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTAGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAA
GGATGTGCTGTTAAACAACATGGCCGGTAGCGTACTGTACAATGCGCTGGATTTAGTAGACAGGTACTACCAGATCCTGATGCGAGATAGTGACATCCCG
CTCACCGCGGCAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCCAAAGCCCCGGCGACGTTCAATCGCCTGGTGACGC
AATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCATGCCGAAGGAGGCAAGACGGCCATGGAGGTGCACCT
AGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGCCAAGTGTGTTTTCGCGTCACCAGATATTAAAGTTCTCGGT
TGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGTATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGT
TGGGCTTGGCCAACTACCTTCACAAGTTCAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCGTCAGAAGGACGTCGACTGGCGCTGGGA
GCAGGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGC
GATGCCTCCGATTACGCCATCGAATGTGCATTGCTACAGGCCGACACGGCTCGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCG
AGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAGTATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTA
CACAGACCACGCGTCCTTAAGGACGGCGACTAACTCGCCTCACATCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTC
GAATACAAGCCGGGCAAACTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGCCCACATCATGCGGGTGACAACGGATCTATATG
ATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCG
ACAGCGCTCACGGCTTCACCGATATGAGTTGAAGGAGAGCCTCCTCTATTACCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGAAGAG
GATCTGAAGTTCGATATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGT
GGACCCACATGAGCAAGTGGGTCGCCCGGTACGCTAAAACATGCGAACAATGTCAGCGGGTCAAAACCGCAGGGTACTCTTCGGCTCCACTACAGAGCCT
GCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGCTCGTGTGT
CGGCTGAGCAAGATGGTACATCTTGCTCCAGCTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTC
TCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGAAAAACGTTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGC
GGACCATCCGCAGACAGACGGCCAAACAGAGCGCGCCAATCGAGTGCTCGAGGACACTCGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGC
AGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCTTCCACGGGGTTCACGCCGCTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCT
CACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAAAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGG
AAACAGGTGGAATCCTTTATGGATACCAAGCTGAGCGTGATCAGCAGGGTCCGCGATGCCATGGCAGCGGTCCAGG