Description :
From Genome Similarity Track
Location :
Scaffold_339:5288- 9449
Sequence
4161 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAATGACCATAAACATGTTGGATGATGAAGGGATAACTTCCATACCACGCATGAAAGCTACTTCCAT
TTGAGTCAAATCGAATGGTATGTCGTCGAACGTTTGAGCTCGACGATAGGGCAAGAAGCCGTCGGCGCAATACTGTCCTCTCTGGGGCCAGACAGACAGC
ACGCCACCATTGCCACGTTCATCCAGAATGAACTTGACGCTGAACGGGAAAAGGTAACCTTGCTTCATTAACAAGGTTCTCAACAGTTTAAACTGTTGAG
ACAGCAGCATGCCGCTGCTACCGGGTCGATACACACACGTCGACCCGAAACATTGAAGATTGACATCTCCAAGTACAAGGGAGTCGATGAAGACTCCCTA
TTGATATGGTTTGTGAATCTGGACGATGCTATAAGGGCTCGTCACATAGTCGATGAGCACATGCAGGTCGCATCTGCTCAATCGAACTTGGTAGGACGTG
CGAAGACTTGGGCCTTAGGCATCAAGCTACACGATCCATATGTCTTTGGGTCGTTAGAAGTCTTCAAATTCCGGCTCAGACAAACATTCGAACCACCGCG
AGCTGAGTCAGGGCTCGCTTTGAACTCCTGAAACACAGGCTAGGCAAACGTGATGTACATTCGTACATTCAGTACATACGTCAACTTACGAGTTGCAGTA
CAGCAAATACGATGAATGAACAAACGTTGATCACGTCGTTCATGCAGGGTCTCACGGACGGTCCAGTCAAAACCTAACTGTTACAACTGGAATTTTACTG
GAAGAGGCAATCCGGGTTGCGGAACAAGAAGATTTCAGTGTGAAACAAGCTCACGTGAATTCGAATCCCTATTGTCCCCCGAGACGACGGGAAAGTGGAG
GCCCAGAGCCAATGGACGTCTCTTACGCTGAGAGTGAAAGCTCTTGCATTACCAATTATACGAAATTGCGGACATGCAATAGCTGTCAAAAGCCAGGGCA
TTATGCATATGAATGCAGTGCCCCGAACGCGGTACGACATACCGCAGGAAACAGTAACCGTCAAGCGGCCAAGAAGGGTCCGAGGCGTGGGTCCGACGCT
GTTGCGAAGACGCAATATCGTGACGGACAGCCAAAAACGGTCAGGGTCAGTAGTTGCGGAGCAGACCCGGCAACGTCAAGTGAATTTGCACGCCTCTTGA
CGAGAGTCGCCCCCAACACGCAAATATTGTGTGTTACTGCATCTGGTAATGAGGTTTTCCTCATTACCACGAAGCTCGAAGTGGCAAAATACATGTCACT
TCGAGCCCTAGTCGATTGTGGGGTGTCGAACAACTTTGTACGACGCCAGTCTCTAGACAATAGCAAGCTTAAATTTATTGAGCGCGAGATCCCTCCAACG
AGGATAACGGTACGCCTCGCTACAGGCGCATCCGTAACAATGATGGAACGTGTAGTGAAAGTTACCTATACAATGAAAGAAGTCCAATGTAATGGTGACC
TCATCGTATTGGACTTGGATACAAGTTTGATGTCATCCTTAATTTACCGTGGATCAGAAGGTACGACCCACAATTCAGCTGGCATTGATGAAAAGTCGAT
ATGCCTATCGCTTCTTCATTAGATGGTCGTCTGATAAACGTCATGGAGCGCCCACTAGCATGTGGGTGTACTACGGGTGAGTGCGATGGCCTCACGTGTG
GTTTGGTCGTTAGTACGACTGCACATGACCACAATATGACTGATCATCACACGGTGGAGCAAGATTCCGGCGTTTGTGTAGAAACGCAGGTAGCGCCGAA
GGCCCACCACCCGAATAAGCCGAGCGGACCGGAGCATGGAGTTTATCAAACGATCAACACCCAAGCAACATTAAACCGATTGCCAATGATTCGCAATACG
ATGATCTTGAATCGATTGGAAAATCGAACGTAGAAGACCTGGCTGCGGTACCGCAACCACCGCCAGAAGACTTTCAGGGAATAAGTCCACTAGTACGTGA
TGATCATATAGCCGAAGAGGCTAGTGAGGGAATAAGTTCTTAACCAACTGTGGAAAACAATTATAAGAAGACAACAGAGACATTAAATGTCCTGGTCAAT
GAAGGATCAAGTATAGGTACCTAAACAATTGATCTAATCGCGCCTCCAAAGTCAACTTCGGAGATCGCTAAATTGCTCACCCTAGGACAGAAAAGGTTCT
TGCGTGATCTTCGTAGTGGCAAATCCAAGCAGATCTGCGTACTCGTTCCAGAGGACGAGTATGTCACCGATATCCGGTCGGTAATGGTCTTTGCCGAGAA
TGAAGGGTTTTCAGCAGCTCATGAAAGGACGAGAGTGTCCTTAATGAAAAGACACAAATTGAGCGATATACATCTCAGCCCGTGCGAATCGCTCCGAACA
AATTCTCCCTACGATGATTAGATCGAACCTAGGGATGCTTTCCCGGAAGTAGTGCCGTGCGAGCTACCGAAGGATAAGGGTACTCGTCATGTAATCGGCC
TGAAACCAGGGGTCGAAGCAGTGTGTCATAAAGCAGTTGTCAATGCCCCGCAAATAAGTACTAGTGGTCGAAAAATCTATTTTGCCGATCGTTCAGCAGT
GGGTCATGTGAGGGAGTCAACCCCCCCCCCACGTATCTCTCCGACCTTTTGTGTGCGAAAGGCCACAGGAGGGTGGCGGATAGTACACGCCTTCAACAAG
ATGAATACTGCCACTGTACCGGCTCAAACACCAATACCAAGGAAAGATGTCATCATAGATGGTATGGCTAAGAGTACCATCTTTTCATCCATGGATCTGA
TGGATAGGTTCTATCAGATCCTTATGCCGGAAAGAGACATTCCCTGTACTGCAGTGAGCACCTAAAGTGGTATTCATTGGGAGTGGTTAGTAATGCCACA
AGGGCTAAGTAATGTACCTGCCACATTCAATAGATGTGTAAGGAATCTATTAAGATCCGTAAGAGAGTTCGCGCCCAGCTACTTCGATGATGTGTTCGTC
CACAGCCGGGATATGGATGGAAAGACGGATGTGGAAGTGCACCGACTCCACGTCCGGAAGTTCTTACACTAATGCGCGAGCATAAGTTATACGCACACCT
CAAAAGGTGTATATTTGGTGCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGCAAGCATGGCGTCTGGCCCGACCCAGAAAAGATCAAGGCGATCACC
GACTGGCCGGTGCCTACAGCAGTCAAGAGACTTCGAAAGCTCCTTGGCCTAGCGGCGTATTTGCATAAATATTCACGCAATTACGCCGAGATGACTGTTC
ATCTCTCTCATCTATTGATAACGAACAAGAAGTGCGTATGGAGTGCTGATTGTCAGCGCTCCTTCGAAGGTATCAAGCAGAGCTTGATCGCCAGTTTTGT
CGATTGCAGATCAAGACAGACCATTCCACAAGTCGGTGACACCAGTGACTTCGCAATCGGCTGTGCATGAAGGCAGTACGATGCAGACGATGTGGCACGT
GTCTTCTGCTACCAGTCGCGTCAGCTGCAAGCAGCCAAGCGCAATTACCCACTGCGTGACAAGGAATTTCTTGCCATGAAATATGCACTGGCTATATTTC
GCGACTATCCCCTAGGAGGTAGACCGTGTGTAGTCTATACGGACCTTACGTTATTACGCACGGCCGTAAACAGTCAACAACACTCTTAAAGAATTGCGAG
GTGGCTGTCCTTCTTCGTGGAGTACAGCTTCTCCGTGGACTATAAGCCAGGACGACTTAATGTCGTCGCTGATGCGCTGTCACGCCGACCGAATTTCGAG
TTGGCTGCGCAAACCAACAGTGGGGTTAATCCCACTGTTGTAATACTAATCGCTAGTGTTTTGTCTTCAATACCGGCTGACGACATAAAGAATGCCTACG
TAGAAGATAAGGCTCTTCTGCGACTGATGGATCATCTGGTGAATCCATCTCGTAAATCGCTCAAAGATTTACCATCCCTGTATTGATCATCCACAGATCG
ATACCAATACGCAAAGGGTTGCCGTATTACACAGCCGTTGCCGGCGATACTCCTTGTTTCGTCTTTCCCACTCATAACGATATGCAATTGCACATCCTTT
ATGAGTCTCACGATGCGCCAACAGNNNNNNNNNNGAGCGATATACATCTCAGTCGTGGGAA