Description :
From Genome Similarity Track
Location :
scaffold_31:52878- 54367
Transcript NameFunction/comments
g195.t1hypothetical protein

Sequence
1489 bases(100 bases per row)
CGATGTGATCGTGGTTGGTGGCGGCCACGCAGGCTGCGAAGCTGCCGCTGCCGCCTCCAGAACTGGTACGAGCATTAAAACGCAATTGTGTCGGCATCTA
CTAACTGCAGGACTTTTTCGCAATTGCAGGCGCTAAAACTGCGTTGGTGACGCAGAAATTGGCAACAATTGGTGAAATGTCTTGCAACGTACGCGACGCA
ATTGCCCTTGATGGTTGTCGAATGACCCAATGAGTAATTTTTGTGTGTGTTGATTCTTTGCAGCCGTCCATTGGCGGTGTGGGCAAAGGCACATTGGTGC
GTGAAGTGGACGCCCTAGGCGGCCTCATGGGCCAAGTGGCCGACTCTGCTGGCATCCAGTTCCGGATGCTCAATTCGGCGAAAGGACCGGCGGTGAGAGG
CCCACGGGCTCAAATGGACAGGGATTTGTACCAGCAGGGCATGCAGAAAGCCCTTGAAACGCTGCCGAACCTCTGGCTGGTGGAGGACGGAGTGGAAGAC
CTCATGCTGGAGAAGGTTGGTCAGAGTGAAGAGCGGGTGAAGGGAGTGGTGACGTCCTCTGGTCGAGAAATTCAGGCGTCGCAAGTAGTAATCACTACTG
GTACATTTCTCCGCGGAATGATATACCAGGGGCCCGACATTCGCATCCCGGCTGGACGCCACATGCGGGACACGGACGGACTTGAGCCACCGGCGGTGGG
TCTCGCCCAGACGCTGGAACGCTGCGAGTTCCCTCTAGGTCGGCTGAAAACAGGAACTCCTCCTCGACTTGACGCACGCACAATCGACTACACGGGACTT
GAGATTCAGCCCAGCGACGATGTGCCCAAGCCGTTCTCGTTTCTGAACGAGCGTAAGGCTGTGCCGCTAGCAGACAAGCAGGTGGTCTGCCACGCAACGT
ACACCAACGAAGAAAGTCATCGAATTGTGCGCGACAATTTGCACATGCTGCCGCAGTACGATGGTGGGAGGGATGGCGAAGGTGTCGGCCCCCGCTACTG
CCCATCGATTGATGCCAAGGTCGTTCGTTTTGCTGACCGCTCGAGACATCAGCTTTGGCTCGAACCCGAGGGCTTGAACACGCACATCGTGTACCCGAAT
GGTATCAGCACGGCGCTGCCCGAAAAGCTGCAGCTCGAGCTGCTGCGCACCATTAAGGGACTCGAAAAAGTGGAGCTCGTGCGCGCTGGATACTCGGTCG
AGTACGACTATGTGGATCCGCGATCGCTGCACCCTACGCTCGAGACGAAGAAGTTGCCGGGACTGTATTTGGCAGGTCAAATTAACGGCACCACAGGGTA
CGAAGAAGCCGCAGCGCAGGGTATCGTGGCCGGCATGAATGCCGGTCTGAGTGCCATGGGACGAGAGCCGCTCGTGCTTGACCGTGCTGATGCTTTCACA
GGCGTGCTTATCGACGACCTGATCTCGTTGGGAACGACAGAGCCGTACCGCATGTTCACGTCTCGATCGGAGTTCCGTCTGCTGCTTCG