Description :
From Genome Similarity Track
Location :
Scaffold_62:52862- 57250
Transcript NameFunction/comments
Physo_138279hypothetical protein
Physo_138280PREDICTED: acyl-Coenzyme A oxidase 2, branched chain isoform 2
Physo_138281hypothetical protein

Sequence
4388 bases(100 bases per row)
CCTCTAAAGTCCTGGACTCCAGGCTGGAGAGTCCCCAGTTCCGGATGGATACACCCTTCGGCAGAGTCGCGGAGAACTGGAAATGGAGCCAGCTCCTTGT
CAATTGTTCACTGTGGACCACACGAAAGAGGTCACGGCACTTCTGATACGCTGCAGCTTGACCATGCGTTTGACAAGCATGGGTCGGAACGTACGCGCCC
AAAGCGTAGAGCACAGAGTTCAATAGTGTATATATCTCATTGAATATAGATATGGGCCAGTTCAGGCCGACCGCAGGGCGAAGACTGGCGCAACCATGAC
GCTCTCGAAGCGGAGGATCACGTACAGCATCTCCATGAGCCAGTACTTGACATCTGCCGGCGCGAGCGCAGGCAGCCGGCGTAGCGGAAGATGCATCCGG
GGTCTCTACCGTCTCCGCTTGCCGCGAACCTGCTGGAAGGCGATGGCGTGAACACCAGCGCGGTGAACAGCTGCAGCCAGTGGTGCGACTTGGGCAGGCA
GCCGTAAGCGGCGTTGTGCTCCAGCGTACGCAAGAAAATGACATGGTTGCGTCCGTGCTGGACGCGCATCATGCTCTCAACCGTGTGCACCACCGCTCCA
GTCTGCGGGTTGAACATGCAGCGATGGAGAACAACGCCGTCATCGTCGACCCGCTGCAGTTGCTGCATCTGGATCGTCACAACAGGATGGAAGAGCCTCG
GGTGCGTCTCTGGTTGGCACAACTTGTCGAACGTCGTCGTGTAGAACGCCTCCGCGTTTAAGTGATCGAACCGCTTGGACATGACGAACCGCGTCGATCC
TTGCTCCAAGTCGATCTTCCGTCGGTCACTCCAGCCCATGACAACGGCGCCAGTGCTCTCATAGTCCGTCTCGCAGCTCGTGGCCTGGAACTCCTGCAGG
TTCTTCCTCAGCAGTTCGTTCCAATCTTCTGCAGTTAATGGGATGTAGTGCTCTCGGATCAACTTCTGGTGGCCGGCTAGCAAGAGCTCAATCTGCGCTT
GGCTCGGGTAAGGCAACGGCGCGCAATTATTCAGATTTGCCTTCAACGCGTCGTGTTCCGCTTGTAGCTGCTGCTTCTCTCTTGAAATCTGCAGCAGGTC
GCGCTCCTGCTGCAGTCGCTGGACTTCCTCCTTGACACGACTGACCTGGTCCTTCTTGCGCTGCATGAAGCGGCGCTGCACCGCGCGGTGCTTGGACTTG
CGCGTATCATTTGCAATTTGCCTCGCAATCAGAGACCGATAGCGCATAAGCTGCTGGGCATTGGACTCGTCGCTCCTGCCAACATGAAGTCGTTAGTCAA
GCGTACACATCAAATTTTAGTCCTTGCAGTTTGCGCGTACTTGTAGCTGCCCAGCGGCTGGTCGAACAGCAGCGTTTCGATGATTTCCTGGTCCGTTTGC
GTCCAATTGACAGGCAAGTGCATTGCTTCGGCCGGTGGCATTGACAGCAGAGAGCCTCGGCGTGAAGAGATCCACTTGACGTTCCCGGTTGGACCACCGT
TTTGATGGGACTATTAAATAGTCCTGTCAAAATAGGTATAGTCCAATTTAACGTTAATCTCAACGTTTGTATGAGACTCAAAAATTGCGCATCACCATCT
CGTCCACCAATTTTCAAACTCAAGTTGACACGCATGGCGCCAGTGTCCTCACTTCCGCTGCACGACCCGGCACCACTGCTACTACGCCGCGAGCGTCAAT
TCAGCGATGTGGACGTGGAACTATTGGCCGATGCATTGCGAGGAGGTCGCGAGGCCAACCGCCGTCGCAAATTAATGGTGAAATTGGTCCGCCGCCACCC
GGTACTGTCACGTGGAGACTTCATCTACTAGAACCACACACAACGCTGCGCTGCGGGCTTGGAGAAGGCCTACCACTACATTAAACTAGTGCAAGACTAC
AACGTCGAAGACCCGTACGACCAGCAGGAATTGTATGTTGCGTTGGGCGAGCGTCTGCCGCTGGAAGTGCATCGAGCCATGTTCGTCCCGACGCTCGAGA
ACCAGGCCGTCAACGAGCAGCAGGCCAAGTGGCTGCCGCTTGCGAGGAGCTTCCGCATCATTGGGGCCTACGCGCAGACGGAATTGGGCCACGGGTCCAA
TGTGCAAGGCATTGAGACGACGGCGGTGTACGACAAAGAGAGTCAGGAATTTGTGATCAACTCCCCGACGTTGACCAGTCGGAAGTGGTGGCCAGGGGGG
CTGGGAAAGACGGCGACGCATGCAATTGTGCACGCGATGCTGGAGGTTGGTGGGGAGAAGAAGGGGGTTCAAGCGTTCATTGTGCCGCTGAGGTCGCTGA
AGGATCACACGCCGCTACCGGGGGTCGAACTGGGCGACATTGGACCGAAAGTGGGCTTCAACTCGCTGGATAACGGCTACGCGGTCTTCCGCAACGTGAG
AGTTCCGAGACGGAATATGCTCATGAGGTACACGAAGGTGCTGCCCGATGGGACTTTCGTCAAGCCCAAAAGCTCCAAGCTCGTGTACTTGACCATGACG
CAGGTGAGGGCGTATCTGATCCTAAAGTTGAGTTTCCTGCTCGGAGCGGCGACGACCATCACGACTCGATTTAGCGCCGCACGCATTCAAGGGAGGAGCA
AGACAATAGTTGGTCGGGGCTTGGAGATGTTGCCGAAGGAGGTTCAAGTGCTGGACTACCAGAACCTGCAGCACGCATTGCTGCCGTTGATTGCATTGGC
CTACGCGGCCAATTTTGCTGAACGAGCGATGACGGCGTTGCACGATGATACTCTGAAGTTGGTGAAAAGGGGGCACGACTCTTTCGACTTGCAAGTAGCT
GAAGTACATGCAGTGTCGTCTGGATTGAAGGCGCTGCTGGCAGACCGAGTGAACGATGGGATCGAGCAGTGCCGTCGTTTGTGCGGAGGGAGCGGTTTTC
TGCAGGCGAGCAATTTGCCGCATCTCTTCGCTGAAAACGTGGGGCCTTGCACGTTTGAAGGCACTTTCGACGTGCTGGTTCAGCAGCACGCACGTTATCT
GCTGAAGGCTTTTGCCCGAGAGAAGCGCTCCAGCGACTCGAACGAAGCTAGCGATGAAGAGACTCCAACGAGCTTCTTGCGCTACACCGATCTGTACGTC
AACCATCGACTCCGCTGCAACGTCCATCACGCAGCAGACTTTGGCAGTTTCCACGTTCTCACAGACGCGTTTGAGGTGCGCGCCGCGCGCTCCATCCAGC
GACTTGCAGACGCTATGGAGTCAAACAATGGTCAAAACGCATGTATGCTGCTCATGACCGCCGCCTCGACGCATCACGCGGAATTGATGCTGCTCAAGTC
CTTCATTTCAGGAGTGTACTCGTTACCTTCAGGCAAGACCAAGGCTGCAGTGGCGCAGCTTTGCCAGCTCTTCGGAGCGTACTCCTTGTGAAGGGGTTGG
GAGACTTCCGCCAGCATGACTACATGTCTAGTGCTCAGGGGGATATGGCTCATCAGCTAGAAAAGCTGCTGCCTCCAGTGCGTCGCAACGCTGTCCGCCT
CACGGATTCCTGGGATTTCAGCGACTTCGAGCTCAACTCGGCTATCGGCCGATACGACGGAGACATCTATCGCGCTCTCGTGGACCAAACCAAACGCGAA
CCTCTCAACGCCTCGGAGGTTCCGGAGGGATACGACCAATATCTCCGCCCGCTTTTCAAGTCATCGTTGTAGCTTGCTGGCTTCTCGCGCATGTGTACTA
AAGAAACGAACAGCGGTTTTGAATCAAATCCGCTCATAGGCTTCGTGTTAAACCTGCTGGAAGCCCTCCGTGGACTCTGGGACCCAGCCAACGGCTTGGA
AGGGTACTTCTGCTGCGATAATGCTGACTGGCAAGTGCAGGCAGACGTCGGGGCACCACGGGATATCACACTCGACGTCGATGCGGTACGCGCAGGCTAT
CAGCTCTCCTTTGGTTGACGCTGAAGGAAGCCGCTGTGTTCCGGAACGAGTGTGAGCGGCTGTGGCTGGTCCAACGTCGTGCCGGGCGGCACCCCCGGGA
AAGCGTTCTCGCACATAAGCTTGGTGAGCGTGCGGTACGATCCTGCTCCGTTCGAGAGCTGCACCGTGATGTCTTGGTACAATTTACAGCGCATGGCTGT
GATCTCCACGCTCGACCCGTTGTTGATGTTGCACAGGATCTGCGCTGTCTCCCCTGGGAAGTAGACGCTTTTGTCCATGGCCACAGCGAGCTGGCACGTG
CCGCGGCTAAAGCAGCAGAGGAACTTGACGTCCTGCGTGGTCGAGTCCTCGCTTGCTACCAGCGCCTTGAAGTTGCGTTCGTGGACCACGAGGTCGCAGA
GCTACGCCCCCGGACGCTACATGTATCCGTTCGAGTACCAGCTTCCGGCCGATCTGCCGGGCGCGTTCAAGATCAGCGACTACTCCGA