Description :
From Genome Similarity Track
Location :
contig_49:52844- 70847
Transcript NameFunction/comments
g9670.t1hypothetical protein

Sequence
18003 bases(100 bases per row)
AAGCACTAAATTTCCGTATTGATTCGAATTCAGGAATGTTATCAGTTGCCAACTCCACTGCCCTCAATTACGAAGTTAACCAACAACTCACAATTACTGT
ATGCGCAAAGGATGGTGGGAATCCACCTTTAGAAGGATGTGGATCTGCTACAGTAATTTTATCTGACGAAAATGATGCACCGACAATAGTGTCTCCTCGG
ACATGTGAAATGGACGAATTTCCTTATCACTTAAATGAACAGGAATTAAATCTACTAGTTGGGAAGATTGTGTGCAGTCTCACGGTTCAAGATGAAGACA
AAAATGGAGCAGCGAACATATCTTGGAAGATACACACGTGGGATATCGTGGAAAATGATCAAAAGAGTCCTTTTAATATTACCCCACAAGGTCAGATTGT
TGTGAACATGCCCCAGAATATCAACTACGAAGAGCAACGTATTTGGTCGATAATGGTACAAGCAAGCGATTTGGGAGGTTTGACTAGTCCCCCGCAGAGA
CTTGACATTGTAGTACGTGATGTTAACGAAAAGCCTCAGCTCCTCGCTACAGCTTTTGACATAGATGAGAACTCACGTTCTGGGGCTGAAGCAACGGGAA
ATCTTACTGTTTTTGACCCCGACATTCGCAATGATGGCCGCCCAGATGCTGTGAAAATCCGCTTGGTTGGCCAGCTGGACATGTTTAACGTTGTGGGTAA
CAAAGTTGTGTTAATGCATGACGGGCTTGATTTTGAATTCAAGTCAACCTACGTGCTTCCATTATCGCGACGGACGAGTCGGGGGCCGAAAGCAGCGTTC
TAAACGTGAACATTCTGGTCAATAACCTGAACGAGCCACCCATCGTTGAGTCGATGCAACTGAATATTTCGGAAAACCAACCTGTTTTAACGAATGTTTT
ACCTGCTGTGAAAGCTCGAGATCCAGACGGTGACACAATTTTTTTTAGCATCGTTTCGGAGTCACCGGAGAGTGGAGTTCCACGGGCCCCAACATCATTT
GGCATTGATACCCTGACAGGCGTAATATTTCAGCAAGCGGAACAGCTAGACTACGAGGAAACAAGCGAATACGCTTTACTGGTAAGAGCGGGAGACGCGT
TTGGATTATTCTCGATTACCAATGTTACTGTAAAGGTTATCGATATTAACGAGAGGCCAACAATCCGAGTCCAAAGTACGTCTGTACGAGAAGATGCAAT
TATTAGTACACTTGTGGGAAGAAATTTTGTCGACAGCACTATCGATCCCGATTTAAAAAATGGCCATGAAGTGTTTTCCTTTGAGCTTGTGATCACTAAT
CAGACAACCTTTGCCATCGATTTACGGTCAGGTCAAGTGAGTCTGTCGGGTCGTCTAGATTATGAAGCCAAGTCCGTGTACAAGTTACGTGTGCGTGTTA
TTGACCATGGCGGCTTATCTGATGAAACCGATTTCGTTGTATACATTGACGACGTCAATGAGCCACCAAAAATTGGTTCCTTCAATTTTTTTGTACCAGA
AAACCTTACACCTGGGTCAGCCATAGGAGACCCGGTGACTGCAGTCGACGAGGATATCGATTCCATTATTGAGTATGATCTCGTTGGTTCAAGTGAACCT
GTGTTGGACTGCATCAGAATCAATTCATCTTCTGGGCAGTTAATGCTTAAAAGTGACAGCTCACTAGATTTTGAGTCTTCTTTCGGGAATAGCCTTCCTA
TCGTTGTGCGAGCATCTGATGGAGAGTTCACTGTGGTTTCCAAGAGCGTGATCTACATAACGGACGTTAATGAACCTCCTATACTGGAGGGATCTCTTAC
TACACTTCTACGTGAGAATTCGCCAGATGAAACAGTTGTGTTATTCATACTGGTTCACGATCCCGACAACGGGGACAAGCACCAGTTTTGGGTTTGCGAG
CAAAGCCACTCACAAACATTTCGCGTTCAAAATAGAGGCTTCAACGGCGCAGAGATTATCGTACAGAACTCCACTGCTCTCAATTTCGAATATGTGCCAT
CGCTTTGGGTGGATATTTGTGTACAAGACCAAGGGAATCTGACTACGAGATCCAGGTACAGCGTTAATCTATTAACGTGTTGGAACCGCCATACTTCGAC
CATGAAGTGATTCAATTTGATGTAACCGAGAATATTGATGTTGGTAGTGCTATCGGTAAGCCTCTCACTGCTTTTGTTGTTGACGAAGAAAACTTGAATA
CAGTTGTGGGATGCTCGGTTGAGATGGTCATTACAAACACGACTTGTGGTCGCCGTACTACATTTTGGCTTGACTCATGTGGTCAACTTACCCTTGCAAC
TGGCGGATTGGACTATGAAACCATGCGGGTGTGTGTCGTCTACATTGTCCTTCCTGATACAAGCGCATACAATGCCAATACTTCATCATTGCACCTTGCG
GATACGGCAACGATTATTTTAGCTGTTATTGACGTGAACGAGCCCCCAATTTTCTCACAGAAATTGTACCAGTTTGCGGTCGCTGAGACGGCAACCAAAG
GTAGCATGATTGGCATTCTATCAGCTTCTGATGTTGATGAGAACTCTGTTTTGGGTTTTCAAATGGTAGACACCGACCCAGGAGATGAGGGTGCATTCAT
GGTATCAGCAGCAGGTATAATCACTCTTACAAAACTGCTGGACTTTGAAACTAAGCAGTATTACCGCCTATTTATTCGTGTAATTGATGAACAGAAGGAA
TATGCTGATACAACAGTAATCGTGACTGTCACGGACAGCAATGAACCACCCGTTTTTCAAGCTGATCGATACATGTTCAGCGTTGTGGAGAATGCACCAG
TTCAAACACTAGTCGGGCGTATCACCGCTGTCGACAGTGATAAGTATCAAAACAGCACCATTACGTACACCATCGCAAATGGAAATGACTTAGGCGCTTT
TTCAATATTATCATTTGGTGGAGATGGGAGCCTGGTCGTAAGTAACCAACTAGCCCTTGATTTTGAAAGACAACAACTCTTTACGGTGCTAGTTGCTGCG
ACAGACAATGGGCCAGGAGGATTATGGAGCTTTTCTACGGTGTCTGTTCGTATTCAAGATATTAACGAACCACCTCAGGTATATCCTCAAACGCTGTATG
TCGCTGAAGATGCTGAGATTGGGTCTTCTGTGTTCACGTCACCAGCTCTTAGTGAAACCTTGACTGGGCAGATGGTTGCATTCGACCCCGATTTTAGTGA
CACGTTGATTTTTGAGATTGTTGATCCAACGTTCAGTATCGATTTAACTACGGGGGTTATTCGTACGAGACAACAGCTTGATTTTGAGAAAAAGGGGCAC
TACTCTTTTTCAGTGGTAGTATCTGATAGTGGCAATCTGTTTACTACAGCGACATTGGACATCGTTGTTTTAGACAGAAATGATGCTCCAACCATTGTCG
CTACCGATTTTTCGATCATTGAGAACCCAAATCAAAGCTCTATCGTGGGGGTTATACGCATTACCGACGAGGATTTCAACCAGAACCATTTTTTCACTTT
GATTGAAACTACTTTGGTTCTGCGGGACAACTCCACTGTTTTGAGGCCAAAAAACGACGTGGTAACTGTGGGCATGGTTTCAAGCTCCATATAGTTCTTG
ACGGCAGTGCTTTTGACTATGAGTTCGTACGTAGTATACAACTAGCCGTGGAAGTTCATGATGACGGCAGCCCAACCAAGCAAGCTACTGGTACTTTGAT
TATTGATGTGATGAACGAGAACGAGAAGTGCACCTTTGAACAGCCTATCATGACATTTGCAATAACAGAGAACACGATTGGTACTGTTGGGCGAGTCGTG
GCGATCAATCCAGATGCAAATACCTCAATTTCTTGGGGGTTGTTGAGTTATTACATGATCGGTGACGGAATGACAGATATCACCGTCGTTGTTTCAGAAA
TGGGTGACATCGTAGTAAACAACCCTTTTGACTACGAGGTTCAACGCCAAATATCATTTAAGGTCGGAGCTGTGGACGGAGGTGGCCTCACATGCACTGC
CACAGTCCAGCTACTTGTGCTTGACATTAATGAGCCTCCGGTTATCAAACCTGGCCGGTTTTGGGTGCCAGAATCTGTCAATGAAGAGCTAGACTGGGTG
AGAGCAACTGATGGTAGCCACGCTCGGGTGACATTCTGGGACCCCGAAAACGATTCCACGTCACTTTCACAAAACTCATCGAATGTTTTTCATATTTCGA
ATGATGGGTTAATATCGCTGCTGAACCCTGTTGACTACGAGCTAAAGTCGTATTACGATCTCTATATTACTGGGGTGGACAGCCATAACCTTCGCTCAAG
CGCGATAGTGCGAATCGATGTTGTGGACGTCAACGAACCACCAGTATTCACATCGCAGGCAAAAATGAGTATTGCTGAGGATTCACAGAAAGGGACAGTT
GTGGGTATCGTGGGAGCTGCTTATGATCCTGACGAGTACGACGTTATTTCATACCAGATCGAAACTGCATTGGATCAGAGCGGAGTATCTGTCGATATTT
TTATGATACACTCGTGTGATGGAGAAGTGCGGTTGTCTAAATCTAATTCTCTCGACTATGAAATAAACGATCGATACGAGCTAGTAGTAAGTGCAACCGA
TCGCACTGGTCTTAAAACTTTGTCGGATATAATTCCAGTAGAAATCATCGACATCAATGACATGCCGATCTGTGAAGACATGAGACTTTCTGTTTTTGAG
AATGCCTCGGCATCCGAGAGGTTCGGTCCTCTTAAGTGGAATGATCCGGATTCATCTATCAAAAACACGATTACAGTGTTTGAAGTTGTCAGTGATACAG
GTGACATTGCTTTCGATATTTTTGAGGTTCAGCCCCGTGGTAATGCCTACTGGCTAAAGTTACAACGCTCAGGCACTTTGGACTATGAAAATGTGGCCAT
GTATACGATAACCGTAAAGATTGGTGATAGTTTTGTCTATAGAAACGACTCTGCGGGACAAGTTACGGTATCGTCGTTGTCTTCCACGTGCAGCATAATT
ATTGATGTGCTGGATGTCAATGAACCACCCCACGTCGCAAACGTATTGGAACAGTCTGTTGAAGAAAACACGCCCCTATATGCTTTGGTCGGCGTACCAA
TCGATGCATTTGATCCGGATGGTTATGACGTTTTGCACTTCTCAATACTACCTGATGAGGCCAACGGAGTACCTTTCACAATTGATTACAATACGGGTCA
AATTCATGTGGCCGGAGATTTGGACTATGAGACTCAATCGCTGTATACGTTTGAGGTTGCTGTTGAAGACACAGCTTTAAACTCAGTGGTGACACAAGTC
GAAATTAGGGTTGTGGACATAAATGAGAGACCACAGATACACCGGAACTGCTTAGTTCGTGAAGACGGCACAGCTGATAACCGCTACGAAGAGAACCAGC
ACGTCTGCCTCCAAGTATATGAGGACGTGGAAGTTGGATCTATCTTGCATCACTTCGAAGCGATAGACCAGGACAGTGACCAGCGACTGTTTTATTCGAT
TGACGAAAATTCAGCTTCCTTCGCTCGGGTGGTTCAAGATACCGATCGAAACTGTAGCCTGTTATACAGTCGCGAGCTCTTTGACTACGAGAGTGCGCGG
GTGCACCGGGTGCAGTTAATCGTCACAGATACGGGGAAAGGCTTTCTTTCAGATACCGTAACCGTATTCATATTTGTTCTAAACGTCAACGAGCCCCCAG
TACTTCTTCAAGCGTCAGCGTCAGATCTTGTGCTATTTGAAAACTCTGCAAGTGGTCATGTATTGGGCCACCTTCAGGGCATGGACCCGGAAGGAGACAA
GTTTGTATTTTCTCTACAAGATTCGCGTCCTATCGCTAATGCCATCACAATTGATGCTGATGGTTGGGTAGCAACAACGAAAGTAGCTCTTGACTACGAA
GCCATGAGAAAGGTGAATTTCGGTGGGCCTGAGCCAATGCTAACCATACGAGGGGCAGTGACCGCATCGGATAACACCTCGACAAATTTCAATTTTACAA
TTATGGTATCGGATGCACCGGAATTGCCTGTGTTCAGACTATCTTCATATGAGCTATCTGTTCATGAACTGGCCCCTGGAGGCTCGCTTATTGGTGTCGT
CCAAGCTACAGATCCCGATTTGAACGATACAATTCAGTATGGATGGAATATGGAGGATACTGCAACCTCAGATGTGAGCAGTATCTTTGCGATATCTTCT
GACTCAGGAGTAATATCCCTGATAAAGCAAGGGGTTTTATATGCAGACAACAATGAAGCTTATCAGCTTAGTGCACGTGTGACTGATTCATCAGGGTTAA
CGAATTCCACCAATGTGATTATCTCGGTCGTAAACGACAATGAGCCTCCAATTTGCCCGCCCTTTCAGTGTTGGATACTGGAAAATTCTCCTTTGATTAA
CAGAGGACTGCCTGGGACGCAAGGTTTGTGCCAGATAGTAGTGCAAGACAAGGATGCTGGGCAAAATCACGTTTTTCAATTGATTTCCACAAATGATAGT
CGATCGTTCGCGGTCGATTACGCCACTGGCGTAGTTCAGTTTGCTGCGAATCAACTTACTTTCGCGGATTTTGAAACACAAAGTCTGTATCGCATTCGTT
ATCAAGCGAATGATGTTCCAAGTACTGGTGCCTCACTCGCTTGCAGCAACGACATTGTGATCAGTGTTATTGATGTGAATGAAGCTCCAGCAATTTCTGG
AGAGCAGTCTCTAGTTGTGAAAGAAATGAGCGCACATGGTACGATCGTCGGATACGTAAAAGCCATCGACCAAGACTTTGGTGATATATTGAAGTTTTCG
TTGCAAAATGCGGACTCTTCACAGTTTAATATCGATGCAGCAACTGGGGTGCTAACAGTAGTCGACGATTACAAGATAAACTTCGAAACTACACCGTCGA
TCACCGTTAACGTTGTTGCAACCGACGTTGCAGGACTTCATGTTTCGGCAACGCTTCTGGTTACGGTTTTGAATGTGAACGATCCGCCAGTGCTACAGCC
TGTCAACTTTACAGCAAGAGAGTCGGTAGTATCGAAACCAGCCGCATCTACACACTCGCGAAACTTAGAGCAACTGGGGGTGATTCCTTGCTTTGATGAA
GACATCGGTGACGAGTTATATTTCAACATTCTTAACGATACGGCAGCCTTCAGTGTAGAACATAAAAGTGGAATTGTGTATGCGGAAACAGCTTTTCTTG
ATTTCGAGACACAACGGCAATATGAACTCAGTGTTCAGTGCTCAGATGGCCAAGCAACTGCGATTACCACCGTCTGGATATTCATTTTGAATATCAACGA
AGCACCTGTTCTCACTGGTAAAGCGTACCGCGTGTATGAAAACGCAGTAATTGGAACTAGCTTAGGCTATATTAATGTTTCCGATCCAGAGCACGACGAT
GAATACTATTTGACGTTGACCGAACCAGCTGGAGGCAATGCTATAGTGTCAAGTCTGAAAGAAAAAGGATCTGTATTCTCTGGTTCTTCTGATTTCGAAT
GGATAGACATTCCACCTCAGCTGGCAAATGCCTTCGTGATATCCACACCTACAGCAGTGTCTTTGTCGAGTACCGCGCTGTTTTTAGCGAGCCGAGGCAG
TTTGTTTGTTTTGGTCGAGCAGGATGCTGACCTTGTTCCAGAGTGGGTATCGAAGAACTCATTCATAAAGAGTGGCGGTCAAACTGCAATAGCACAAAGT
AGTGCAAGTGCGCTTATTTTCGATATATATATCAAAAAAAACGTCCTCGGGGTGTTTGAGATACCTGACACAACATCAACGAGCATGCTGTGCATTTTTG
GTGCGTATCCGGCTTCTTTAGATTTTTTTCTCCATGGTTCAAAGAGCGATTGGTTTGGTGTCACGGCATCTGGAGAGCTGGTTCTCACTAACCCGACGCT
CAATTACGAAGACATTGATTCCCGCGACCAGCCATTGCAAGTCGTTGTGATTGGTGTCGATAGCGAGGGGTTACTGGGAGAGGCCACATTATTTGTTTTT
GTTGATGATGTGAATGAGGCACCCATCCTTTCTGATAGTTATTTCGAGATTCAAGAGAATCCCGCTGTTGGTACCATGGTTGGTGAGCTTGTTGGTAGTG
ATCCCGACTTCAACGATCGGATAGCATTTCAACTAGCATTTCCATCACCAGACGTTTTATTGACGCCGGCTGGACATGTGTCTGTACGCAATAGTTCAAG
TTTTGATTTCGAGAAGAATTCATTGGTCATGGTTCGCATCCAGGTTTCTGATATAGCTGGTCTGTACAGTGACCGCGAAATTCAGATCAAAGTCTTGGAT
GTTAACGAACCTCCAATTTTCCAGCAAGCATACTATTCATTCAGCGTACCTGAAAATTCCATATCGGGGCTACCATTTGGAACGCCCATGCGTGCTATTG
ATCCGGATCGTGGTCAGACCGAGAATTTACGATATGAGCTGGTGAATCGAAATGCTGGCGGTTTGCCATTTCGGCTCGAAAGTTGCTCTGGGCAACTGGT
AGTACAGTGGGATAATCTAGACTACGAAAGTACCAATCGCTATTCCTTTGGCGTCCGTGTTATTGATTCAGGATATCCTGTTGCTCTGGAGTCGCAAGCA
ATCGTGGAGGTCACGATACTTGATGTAAATGAGGCTCCTCAATTCGCTCACTCTAGTTCTCAAAGTATACTAGAAAACGAACCTAATGGAACGTTTATCG
GGACTGTAGTGGCCACTGATCCTGATAAGAATTCTGAGCTGTTCTTTCGAACGAATGCTAGTGATTATATTCGCGTTTCCGGGAACGGTGGGCTGTATTC
GATGGCTCCTTTTGACTATGAAACAATGCCAGTACTCTATATTGAAATTACAGTCGAAGACAATGGAGTGGGATGCCACATGCTACTGGAGGAGTCTCAG
TGTGGGCCAATTATTACATCTACTATTATTACTTTATCGGTCCAAAATGTCAACGAACCCCCCACTCTGCTGGCAGATATGTTCGTCATAAAAGAAAATC
TCTCTCCAGGGTCCTTAGTTGGAAGACCTATTCAAATCGTGGACGTTGATGGAGTTGTGGGGAGCAGTTATGGGTTTTTGATAAAAGAAGGTATTTCCAG
TGGAAACGAATCAGAGTTTTCGATTCGAAGTGATGGTCAGCTGCAAACACTTGTGTCTTTGAATTTTGAAGCAAAGCTCAGTATGAGCTGAAAGTAGCGT
ATTCTGACGGTGAGTATTGGTCCTATCTAAACGTTACAGTCACCGTACTCGACGAAAACGAGCCTCCTGAGGTTGTTACTGGCATCAATGGGTCTGTCCC
AGAGAATATGGCTGCTAGTACTAGTGTTTTAGTAGCAAGGTATGTTGATCCTGATCGCAGCTCAGACAATATTTTTGCCCTTGTGGATAGCTTTGCACCG
TTCCAAATTGATCCACAGACGGGGTCTTTGAAGACAACACGCTCTCTAGACTTTGAGAAGGACCCTACTCGCTTCAATCTTAACATAAGAGTTTGCGATG
CAGCGCAGACAAGTTTATGTGGAGTGGCTACGTCACAGTAACGGTTACTGATGTCCCCGAGATGCCTTTGATGAGTGATGTTACTTGTGTAATAGTGGAG
AATACCCCGACTATTTTGAACGAACAAGGCACAGCCGCGTGCACGTTTAGCGCTACTGATCCAGACAGTGCATCGTGCTCGTTCTATCAAATTATCGGGA
CTAGCGCACAATTCCAGTTGGTGGATGACACGACAGTAAATGGATTAGTCTCCGCAGGGGTTCTTGAATCGACTGTATGCATCAACGGTCAAGTGGGCTT
AGTTTGGAAAGGATCATCCCTGCCAGATTACGAAACTCAGTCTCAATATGTGCTTACAGTTCGAATTTCAGACAAGACAGTGAAAACAACGTCTCTATAT
ACTGAGAGTCGTATAACTGTGACTGTTCTCAACGCAAATGACTGCCCCGTGCTGGCTTCTTTAACATTCACGGTGAGAGAGCGATCCTCTGTCACCACTC
AAATTGGCTATCCACTTCCGGGTAAAGACCAAGATGTTTCCGATACTCTCACGTACAGCATCTTGGAGACAAATGCTTCAGCGGGTTTGATTCTAATAGA
CGTGCTGACAGGTCAACTTAGACTTGGTCGGAACCCTTTAAACGCCGAGCTGGTATACCCGGCTCAATACTATGTGAAAGTTGCTGTTACCGACACCAGC
TATGATCACTGTTCGGGTAACGGACTCATTCAAGTTCTAACGACAAAGTCAAACTTTGCACCTGTCTGGTTAAGCACGTTGCCGTCGTCACTCGTGATAG
CTGAAAATTCAGGGGCAGGAATGCAAGCGGGGGCCTCCCTATCTCATTTTGTCAGTGATCCAGACAGCGACCCAATTCAGTTTACATTGCAGTCGAAAGC
CGACACATACTGTTCAGACATGTTTATCCTTGGATTGGCAAATGGCGCTCTGACGCTTCGTGCAGGACGCACTTTGGATTTCGAGAAGAAACGCGCATTC
GTATGCACAGTAGCGGCATGTGATCCAGCACACATGTGCAGTACACAAGACGTCACTGTTCAGGTCATAAATGTCAACGAGGCACCTGTATTCAGTGACC
AGTCTTACGCGTTCCAGATAAAAGAGAATGAAGCGGTGAATCTAGCCCTTCCGCGTTGTATCAGTGCGGCTGATCCTGACGAAGGCGATGGTTATTCACT
TGCTTACACGATTTCGTGTGCAAATACAGCTGATTGCTCTCTTTTCGCGGTACAAGTTGAAGAGGACTATAGCCACGAGCTGTGTGCTAGGATTGTGGTC
AAACAAAGCTTTAACTTCGAGGTACGACAAGTCTACAGCTTCACTTTGATTGCTCAGGATGCTGGTAAGCTGACTGCGGTGGCTGGTATCACAGTTGAAG
TGGAGGATGTAAATGAGATTCATTCATTTATTGGGGTTCCAGCGACATATTCTGTTTTCGAAAATACGGCAATTAACTCGGTCTTGCTTCAAATCAAGAC
GGCAGACCCAGATATTTACTCTGACGAATTCAAGACAATTCGGTACGCGATCGATGTGTATCCACCAGGACTGAATGTATTCCGCATTGATGCTGCAAGC
GGTGATTTGATAGTAGATGGGCTGATAGACTACGAGGCTGTTCAAGCCTATACAGTGAGCGTTGAAGCTCGTGATTCTAGTGGTTTCAATGCGTTTACGA
TTGTAAACAGGTCGCGGTCGAAGTGGTTGACGTTCTAGATACTACTATTGATACGTTCAGACTTATGGATACCAGCTCCTCAGACCTCGATACGAAGGGG
GGTGAAAGGTTCTTACTCACTGGTTCAAACATTGGGTTCAAGCAACGAGCTGATAACTCAGTTGTAATCAAGCAGCTCATCGTGGAATATGGGGCGTATG
GAGCCACTGCACTATACCGCGCTACAAGCTGTGGGCTCGTTAATGGGAACACCGGAATTGCATGCACGTCAACGCCAGGTGTTGGCGCAAATCTATACTG
GAACGTTACTTTGGTAATGGAGGTCCCAACTATTGGAGAAACCGTATTCCAAGCATCCTCCTCGGTTCCCCTGGCATCCTATGGTGTTCCGGTTATAGGC
TCTGTTGTCTGCAACAGTGCGCTACCGACCGATGGTAGCAACACAAACAATATTAGGATTTATGGTGAAAACCTGGGGTCAACGCAGATAACAAGCGCAG
ATGCATATCTTGTCGTTGTATATGGCTCCGAATTCGAAGCCCAAAGCTGTGAGGTACGCGAAGATGCAACAGGTCATTATATCGCGTGTCGCAGTGTTGT
TGGTACAGGCGCTGATCTCGCATTCGTTGTGGTAGTTCGCGGTCAGGCCAGCACCGCTTTCGCATCTAGCTGTCACTATGCGTTTCCGACTATTTCTGAT
GTAACTGTGGCTGCCGGAATGTTGACCACCGGAGGTGACATCGTAATGGTGAACGGAGCTGGATACGGGTGTCAGGGATGTGGCAAAGTCACTGTGTGGT
ATAGTAACAACGTTCACTCGTTTGAGCTTGATGACTGTAAGGTTGTCATTGATCACGTGCAGTTATCCTGTTTATCTCAACCCGGAGCTGGAGGATTATT
CCGATGGCAGGTTTCCGTGGATGATCAGAAGAGTTACTCGACTACTACAATCACAACTTCTTATAAGGCCCCCGAACTCTTTGAAGTCATGGGCTTCAAA
GATGTTCCTACCGCGGGAGGAACGGTCTTTGAACTCCGCGGGGAAAACTTCGGACCTGACGGTGCTGTCTATACGGACCCCATTGTCGAGTACTCTTTCG
ACAATGTTACGATCCTTCGCAGTGTCAACTGCAAACGAAAATACAACGATCCGACCAATCATAATTTGATACAGTGTGTGTCTGTGGCTGGTAGTGGCTC
GTTCCACTCGTGGCGTGTCACCATCGAAGGCCAAGCATCCCTGTGGACTGCACACAACTCATCGTATGCAGGACCGATTGTGACAAAAGTGTTTCGCCCG
GATGGAGAAACCGAAATCAAGACAAGTGGGGATCAGCAAGTTGTTATCACGGGCAAGAACTTTGGCACCATCAATGCATCCACCATTTCGAGTGTGACAT
ATGGCGTCAATGGTGACGAGTTCACGGCTGAGGATTGTGCCATCGTGGTCGACCACGAACGGATCCTCTGTACGACCGCACCTGGTGTGGGCAATCGCCT
TGCTTGGATAGTCACAATCGATGGTTTAACCAGCGCAACGCCCACGATTAGTTATTCAAGACCATTTATCACTTCGATTGAGGGTAATGGGGCCAACGCT
CTAGTTCGCGGTGGGCAGGCAGTCGTTCTTCGAGGAGGCAATTTTGGGCCCGATACTGTAGTCATCGATGGAATTTCGTATGGAAATTCAGGAAGAGACT
ATCATGTGAAGGAAGTGCTCGAGCACAATGATTCCACAATCATTTGCACATCTGTTCCTGGTGTAGGGGCGAATCTATCCTGGATGGTGTCAGTCGGTGA
TCAAGAATCAAGATTGTCGACTGCCACGAGCTCATATGCACCGCCTGTGGTTTACTCATTGTACCCTTCCGTTGCATCAACTGATGGGACTACGGAGATT
ACTGTTATCGGAGAAAATCTTGGGGCGAACGTGCCTTTCGCAGCAGCACGCGTTGAGTTCACTCCACCGCAAGCAAGTTTGTCAAGTTATCGCATTCCTA
TAATTGGGTTTGGAGATTTTAGTGACAGCAACAGCAGCGAGTACATTGTGATTCGTGTACCGGTGGGTTATGGCTATGGTGGATCGCTGCAAGTGTTGGT
CGGTACGTCGAGTGTTCAAAGAAGTGCACCACAGCCAATTAGCTATGGGCCTCCGTTGATTGACTCGGTATCTACGGACGAAGGCCCCACTGAGTGTCTA
CCTTCTTGCATCCGACTTACTATTACTGGAAACAATTTCTATACCTCGGGGCGCGTGATAGTGTCAAAGTACCTTATCACCGCAAGCAACCTAGAAGGTG
CTAGCTATGAATCTTCAGTTGAGGTTTTGTCTTGGTCTCATAACACCATCATAATCCCGCAGTACGTAGGCCGTCTAGGATACGTGACCATTGTGATTGG
CAGAGAGAAGCTGCTGAGTAATTCTGCGCCGTTCAGCTGGGATGATCCGTCCATTCTCGACTGGTACACACTTAGCTCGACCTGCGGGGTACTGGATTGT
ACAACGAGTCACCGATTGGATGGCAACACGAGCTTATTCCGAACAGTAGCAACTACTCCCGTTATGTCGGGGGTGTTTAGCTACCAATCAGCAACTAGTG
GTGGAGCTACACTAAGTCTATACACGAAGTATGTTGGCCGTAGTCCCCGGGTAACAGTGGGTGGAAACAATTGTACCAATGTCGCGGTGAGCACTCCGGT
CATCCCTTCCAGCATACTTCTGTCTGGGGGGGTCACAGGGGTGAGCAATATCCGCCTGATTTCGTGCACAATGCCGAGCGGTCAAGGCGTCATGCTTCCA
CTTCTTGTAACACGAGGTATAACTCTAAGTAGTCCACGGTATTTGAGTTATATTCCGCCAAACGTGGATTGGGACGGAAGCTCTGCCACTTCTGCTTCTA
CAACCGGAAAGGTTGTTTCTCTCGTTGGATCAAACTTCGGTACCACGCCAGTCATTTCGATGACTGGGAATTCCAACAGAACTGTTTCACTTGAAATCAC
GTCGTATGATCACTCGCGTGCTACAGTCACTATTCCTCCTGGGGAAGGGCAGAACTACACAATAAAGTTGACCGCGGGGAACCAAGAAACTGCAACGGTG
TTTTCCTACAACGCCCCTGTGATTTATAATGTCGAAGTGGTTGACGCTACCACCGAAGGTGGTTCCTTGATGACGATCCAAGGCGAGAATTTCGGGACAA
GCGAGCTATCAGGCGCTCATACCGTTTTAATTGGTGATATTTTTTCATGCACAATCAACAGTGTTAAGCATGCAGTGATTACTTGCATGACAAGCGAGGG
CCAAGGAAGTGGCCATACAATCGTAGTCACTGTCAGTGGTCAAGTTAATGCTGACAAGAATGTGACTTTCAGCTATGACCCCCCGCTCGTCTACAGCATT
AGTAAAAGCAATGGCCCGACCTCTGGGTATTCCTGCAGCTGCACTGATCCAGACCGTCCCTGCGCAACGCTTTTGGCACCGTTTGAGTGCAATTTCCGAA
GCAAGCTCAACTACCACCGAGCTTGGTAGCTATTGCGTGGAAACACTGCTAAATGGGGTGTTGCAAAAAGTAACAGTCACTGCAGAGGCAGATGTGTACT
CCAGCAACAAGCCAGTGTACATGAGTGATGTAGCGACAAATGTACAGCTGCTATTCACCGGTGGGGTTTGGCAATTGTTACAAAGTGATGAACGTATTTA
TCGTGCTAGTACCGCGACAGTGAACCCAACACCTGCAGGTTGGCTCAATGTGATGGTGGATCCACCCGTTAGTGCGGTGGCTATGAAAGTCAACCCGGGC
ACTTGCTCAAAGGCAGCCTCACGTGCCTGTCCTGCAGAAACGGAGCTGTGCGAGAGAGTAGCTATCACACTTGCCGGCAAAAACTTTGGTGTCCAGACGT
TTGATTGGCACCTCGAGCTGGCCAGCACCGATAGCGTGATGGAATCGGTGAATATTACGAGCGATGACATCGTGTACTTCAGCCATTCAAACATCAAATT
CAACTTGCCACCAGGACAAGGCATCTCACGTATTGTCAATATGACTGTATCAGGGCTTCAGCTTGCGAACAAATCAATCGCATTCGGCTATCAGAGTCCT
GAGCTGATCGGCTACGAAACCAATACGACCAACTTGTCGACTTGCGGAGGTTACACCATCTCTCTTTACGGTAAAAATTTCGGATCAACTCGTGCTAAAG
TGCTTATTGGTGGCCGGGATGCACGCGTTGATAGCCAAAGTTCTCACCCGAGGGCTTGTGGATCCGACACATGTGAATACTCGACCAGCGGTCCCTGTAT
TGATACTGATACGTTTGTCTGCTATCCATCGCTGTACGTCGTGAGCCCTACGTTTGGTTTCCTTGAGGTCTGTAACGACACTACAGGGGCTCAAATGATG
TGTGAGACAACAGATCCTGCACCCGATGTGTCTGAAGATTTCACAAGCCACTCTGACTTTGTAATTGTGACAAGTGTGCCTGCTGGGTATGGTGCTGACG
TTTTGGTCTACGTTATAGTTGACAACCAATCCAGTAACGCCTTAACATTTTCGTACAATCAGCCCGTCATCACTGCTCAGATGCCAAATCAGCCCGATGC
AAATGGAGCCAACGCTATCACGATCAAGGGTACCGACTTTGGTTGTTTCCCCAATGATGCAATTACCATTTATTTTGCTGGCTCGGACGATACGTCAGAT
ACAGTACAGTCAATATCCCGCAAATTGAGTTCCCCAGGCATCTCCTACTTGCCAAGTATCTCGAGTATTTTTGAAGACACGTCTCATCGGCAGTTAGTGT
CCGACAGTTCAATTGCCTCCACAAACGTATCAACAGAGAACTCAACCGGGACCGTAGTCTGGACGAGTGCCTCAGAATTGGTATGGTATCCACCCAAAAC
GAAGGCTGGTGTTACGAGCATTATTCTGTCGGTAGGTGGCAACGTGATGTCTGCTACCAGTCAAACACAGCTGAAGTTTCAATGCAGTCCAGGTTACTAC
CGAACTTCGACGGAATTCTGCGACGAGTGTCCAGAGGGGGCTACTTGTGCTGGTGGGGACGAGATGCCGTTAGCCAAACCTGGCTACTGGCGTGAAGGTG
AGGTTGTCCTCGCATGCGATCCCATGTATGCGTGCCTAGGTGCCAACAAATGCGCGGAGGGTTATACTGACATAAGGTGCGGCGAATGCGAGACAAACTA
CCACAAGCTCAATTCAGAGTGCAACGTGTGCCCGGAGAACAAGTGGGGGTCAGTCGCAATTGTGGTCGTCTGTATTAGTGTTGCATCCATCGTGAGTTAT
CTTCTTACTCGAAAAGGAGTGAGCCTTGGTCTACTATCTATCGGTATCGATTACTTCCAGACACTCTCCATCTTCGGCAACGCTCGTATTTCGTGGCCAA
CGTCGTTGATTAATTTATTCGCGACTCTGTCTGCATTCAACCTCAATTTGGAGCTGATTGCACCCGAGTGTTTTTCACTCCAGGTCTCGTTTGTGAATAA
GTGGTTCATCATCGAGGTGTTCCCACTTGTCATGGCGGCCACGGCGCTCGGGGTCTTTGTAGCTCTTTACGCTTACAAACGCTTTATAAAGAAACGACGC
ACACGTCTAACATCGCACCTGCCGCAGCTTTTCGGATCAACGCTTGTGATGATGTATTATCTTTTCTTGTATCTCACACGAACGACATTGGATATCTTCA
ACTGCGTCGGATCGATCCCGTCGGACGGAAAGCTGTACATGGTGGCCATTTATACTCAGTGCTTCAAACCAGGCGGGTTGCACATGCAGCTCTTCCCGTA
CGCAGTGCTGGCATTTGTGGTATATTCGCTGGGCTATCCACTCTTTGTACTTCTGACGTTGTCTCGTAATCGAGCGTTGGTCATGGAAGATCAGCTTCTA
CGGGCTATGCAGAGAGGAACAAGTCGCCGAACCAATCCAAACTGCTGGGTGTTCCGCAAGAAGTTTTCAAAATTGTATTATCAATTCAAGCCGGGCTACT
GGTACTGGATGGTGCTCATTATCCTGAGGAAGTTCCTACTCGCAGGTATCGGGCTTCTGTTCCGTCAAGACCCAGTGTTCCAACTGGCAACAGCGACCTT
TGTATTGTTTGTGAACTACGCGCTACAAGTACGCTGCCGCCCATACATGAGTGTCTATGAGGCACAGCGGGTCTTAGCGGACTATGCCAAACGAGTCCTG
TTGGAAACTCGGCGTGCAAAAGCCAAGGGAGAGGCATTCATTCAACCAGCTCACCTGCGTCTTGAAATGCACGCTTCGACGGTAACTGCCTGGAAGAGCG
GCCATGGTGACCATGGGGGTAATGGTGTGACTGGTAGTTCTGCTCCGCCCACTTCAGGACTTCGTGGAGCTAATGAAGCCATCCTCGCATCACAAGAACC
GCAGAACGTGGTCGGATATCTCTGGGATCACAACACAGTGGAGGCGTGTCTCCTGTTCAGCGCTTCTCTCGTGTTACTGGCCGGCGTAATGTTTGAAAGC
GGTCGGCTTGGAAGTAACGATACTGGATTCACGAGTACTTCGGCACAAATGCTGGCCGTTGCCACCACACTTCTTGTAGCCGCAAGTTGTGTGTACTTTG
CACTAGTTCTGATAACAGAGCTTGTTGTAGCGCTTCGACCCGACTACTACAAACGTATTACTCGGGTGCAGAAAGTTTTTAGTCACTGGCATCGCAACCA
AAAAGATAAAGAGCAGGGTGGAAAGCGTGGAGATGATGACAGTGACGATGACGACGACGACGAGCTCGAGATGGTTGCGACTATGACACAAAATCCGCTG
CAT