Description :
From Genome Similarity Track
Location :
contig_49:52841- 70844
Sequence
18003 bases(100 bases per row)
AAGCACTAAATTTCCGTATTGATTCGAATTCAGGAATGTTATCAGTTGCCAACTCCACTGCCCTCAATTACGAAGTTAACCAACAACTCACAATTACTGT
ATGCGCAAAGGATGGTGGGAATCCACCTTTAGAAGGATGTGGATCTGCTACAGTAATTTTATCTGACGAAAATGATGCACCGACAATAGTGTCTCCTCGG
ACATGTGAAATGGACGAATTTCCTTATCACTTAAATGAACAGGAATTAAATCTACTAGTTGGGAAGATTGTGTGCAGTCTCACGGTTCAAGATGAAGACA
AAAATGGAGCAGCGAACATATCTTGGAAGATACACACGTGGGATATCGTGGAAAATGATCAAAAGAGTCCTTTTAATATTACCCCACAAGGTCAGATTGT
TGTGAACATGCCCCAGAATATCAACTACGAAGAGCAACGTATTTGGTCGATAATGGTACAAGCAAGCGATTTGGGAGGTTTGACTAGTCCCCCGCAGAGA
CTTGACATTGTAGTACGTGATGTTAACGAAAAGCCTCAGCTCCTCGCTACAGCTTTTGACATAGATGAGAACTCACGTTCTGGGGCTGAAGCAACGGGAA
ATCTTACTGTTTTTGACCCCGACACTCGCAATGATGGCCGCCCAGATGCTGTGAAAATCCGCTTGGTTGGCCAGCTGGACATGTTTAACGTTGTGGGTAA
CAAAGTTGTGTTAATGCATGACGGGCTTGATTTTGAATTCAAGTCAACCTACGTGCTTCCATTATCGCGACGGACGAGTCGGGGGCCGAAAGCAGCGTTC
TAAACGTGAACATTCTGGTCAATAACCTGAACGAGCCACCCATCGTTGAGTCGATGCAACTGAATATTTCGGAAAACCAACCTGTTTTAACGAATGTTTT
ACCTGCTGTGAAAGCTCGAGATCCAGACGGTGACACAATTTTTTTTAGCATCGTTTCGGAGTCACCGGAGAGTGGAGTTCCACGGGCCCCAACATCATTT
GGCATTGATACCCTGACAGGCGTAATATTTCAGCAAGCGGAACAGCTAGACTACGAGGAAACAAGCGAATACGCTTTACTGGTAAGAGCGGGAGACGCGT
TTGGATTATTCTCGATTACCAATGTTACTGTAAAGGTTATCGATATTAACGAGAGGCCAACAATCCGAGTCCAAAGTACGTCTGTACGAGAAGATGCAAT
TATTAGTACACTTGTGGGAAGAAATTTTGTCGACAGCACTATCGATCCCGATTTAAAAAATGGCCATGAAGTGTTTTCCTTTGAGCTTGTGATCACTAAT
CAGACAACCTTTGCCATCGATTTACGGTCAGGTCAAGTGAGTCTGTCGGGTCGTCTAGATTATGAAGCCAAGTCCGTGTACAAGTTACGTGTGCGTGTTA
TTGACCATGGCGGCTTATCTGATGAAACCGATTTCGTTGTATACATTGACGACGTCAATGAGCCACCAAAAATTGGTTCCTTCAATTTTTTTGTACCAGA
AAACCTTACACCTGGGTCAGCCATAGGAGACCCGGTGACTGCAGTCGACGAGGATATCGATTCCATTATTGAGTATGATCTCGTTGGTTCAAGTGAACCT
GTGTTGGCCTGCATCAGAATCAATTCATCTTCTGGGCAGTTAATGCTTAAAAGTGACAGCTCACTAGATTTTGAGTCTTCTTTCGGGAATAGCCTTCCTA
TCGTTGTGCGAGCATCTGATGGAGAGTTCACTGTGGTTTCCAAGAGCGTGATCTACATAACGGACGTTAATGAGCCTCCTATACTGGAGGGATCTCTTCC
TACACTTCTACGTGAGAATTCGCCAGATGAAACAGTTGTGTTATTCATACTGGTTCACGATCCCGACAACGGGGACAAGCACCAGTTTTGGGTTTGCGAG
CAAAGCCACTCACAAACATTTCGCGTTCAAAATAGAGGCTTCAACGGCGCAGAGATTATCGTACAGAACTCCACTGCTCTCAATTTCGAATATGTGCCAT
CGCTTTGGGTGGATATTTGTGTACAAGACCAAGGGAATCTGACTACGAGATCCAGGTACAGCGTTAATCTATTAACGTGTTGGAACCGCCATACTTCGAC
CATGAAGTGATTCAATTTGATGTAACCGAGAATATTGATGTTGGTAGTGCTATCGGTAAGCCTCTCACTGCTTTTGTTGTTGACGAAGAAAACTTGAATA
CTGTTGTGGGATGCTCGGTTGAGATGGTCATTACAAACACGACTTGTGGTCGCCGTACTACATTTTGGCTTGACTCATGTGGTCAACTTACCCTTGCAAC
TGGCGGATTGGACTATGAAACCATGCGGGTGTGTGTCGTCTACGTTGTCCTTCCTGATACAAGCGCATACAATGCCAATACTTCATCATTGCACCTTGCG
GATACGGCAACGATTATTTTAGCTGTTATTGACGTGAACGAGCCCCCAATTTTCTCACAGAAATTATACCAGTTTGCGGTCGCTGAGACGGCAACCAAAG
GTAGCATGATTGGCATTCTATCAGCTTCTGATGTTGATGAGAACTCTGTTTTGGGTTTTCAAATGGTAGACACCGACCCAGGAGATGAGGGTGCATTCAT
GGTATCAGCAGCAGGTATAATCACTCTTACAAAACTGCTGGACTTTGAAACTAAGCAGTATTACCGCCTATTTATTCGTGTAATTGATGAACAGAAGGAA
TATGCTGATACAACAGTAATCGTGACTGTCACGGACAGCAATGAACCACCCGTTTTTCAAGCTGATCGATACATGTTCAGCGTTGTGGAGAATGCACCAG
TTCAAACACTAGTCGGGCGTATCACCGCTGTCGACAGTGATAAGTATCAAAACAGCACCATTACGTATACCATCGCAAATGGAAATGACTTAGGCGCTTT
TTCAATATTATCATTTGGTGGAGATGGGAGCCTGGTCGTAAGTAACCAACTAGCCCTTGATTTTGAAAGACAACAACTCTTTACGGTGCTAGTTGCTGCG
ACAGACAATGGGCCAGGAGGATTATGGAGCTTTTCTACGGTGTCTGTTCGTATTCAAGATATTAACGAACCACCTCAGGTATATCCTCAAACGCTGTATG
TCGCTGAAAATGCTGAGATTGGGTCTTCTGTGTTCACGTCACCAGCTCTTAGTGAAACCTTGACTGGGCAGATGGTTGCATTCGACCCCGATTTTAGTGA
CACATTGATTTTTGAGATTGTTGATCCAACGTTCAGTATCGATTTAACTACGGGGGTTATTCGTACGAGACAACAGCTTGATTTTGAGAAAAAGGGGCAC
TACTCTTTTTCAGTGGTAGTATCTGATAGTGGCAATCTGTTTACTACAGCGACATTAGACATCGTTGTTTTAGACAGAAATGATGCTCCAACCATTGTCG
CTACAGATTTTTCGATCATTGAGAACCCAAGTCAAAGCTCTATCGTGGGGGTTATACGCATTACCGACGAGGATTTCAACCAGAACCATTTTTTCACTTT
GATTGAAACTACTTTGGTTCTGCGGGACAACTCCACTGTTTTGAGGCCAAAAAACGACGTGGTAACTGTGGGCATGGTCTCAAGCTCCATATAGTTCTTG
ACGGCAGTGCTTTTGACTATGAGTTCGTACGTAGTATACAACTAGCCGTGGAAGTTCATGATGACGGCAGCCCGACCAAGCAAGCTACTGGTACTTTGAT
TATTGATGTGATGAACGAGAACGAGAAGTGCACCTTTGAACAGCCTATCATGACATTTTCAATAACAGAGAACACGATTGGTACTGTTGGGCGAGTCGTG
GCGATCGATCCAGATGCAAATACCTCAATTTCTTGGGGGTTGTTGAGTTATTACATGATCGGTGACGGAATGACAGATATCACCGTCGTTGTTTCAGAAA
TGGGTGACATCGTAGTAAACAACCCTTTTGACTACGAGGTTCAACGCCAAATATCATTTAAGGTCGGAGCTGTGGACGGAGGTGGCCTCACATGCACTGC
CACAGTCCAGCTACTTGTGCTTGACATTAATGAGCCTCCGGTTATCAAACCTGGCCGGTTTTGGGTGCCAGAATCTGTCAATGAAGAGCTAGACTGGGTG
AGAGCAACTGATGGTAGCCACGCTCGGGTGACATTCTGGGACCCCGAAAACGATTCCACGTCACTTTCACAAAACTCATCGAATGTTTTTCATATTTCGA
ATGATGGGTTAATATCGCTGCTGAACCCTGTTGACTACGAGCTAAAGTCGTATTACGATCTCTATGTTACTGGGGTGGACAGCCATAACCTTCGCTCAAG
CGCGATAGTGCGAATCGATGTTGTGGACGTCAACGAACCACCAGTATTCACATCGCAGGCAAAAATGAGTATTGCTGAGGATTCACAGAAAGGGACAGTT
GTGGGTATCGTGGGAGCTGCTTATGATCCTGACGAGTACGACGTTATTTCATACCAGATCGAAACTGCATTGGATCAGAGCGGAGTATCTGTCGATATTT
TTATGATACACTCGTGTGATGGAGAAGTGCGGTTGTCTAAATCTAATTCTCTCGACTATGAAATAAACGATCGATACGAGCTAGTAGTAAGTGCAACCGA
TCGCACTGGTCTTAAAACTTTGTCGGATATAATTCCAGTAGAAATCATCGACATCAATGACATGCCGATCTGTGAAGACATGAGACTTTCTGTTTTTGAG
AATGCCTCGGCATCCGAGAGGTTCGGTCCTCTTAAGTGGAATGATCCGGATTCATCTATCAAAAACACGATTACAGTGTTTGAAGTTGTCAGTGATACAG
GTGACATTGCTTTCGATATTTTTGAGGTTCAGCCCCGTGGTAATGCCTACTGGCTAAAGTTACAACGCTCAGGCACTTTGGACTATGAAAATGTGGCCAT
GTATACGATAACCGTAAAGATTGGTGATAGTTTTGTCTATAGAAACGACTCTGCGGGACAAGTTACGGTATCGTCGTTGTCTTCCACGTGCAGCATAATT
ATTGATGTGCTGGATGTCAATGAACCACCCCACGTCGCAAACGTATTGGAACAGTCTGTTGAAGAAAACACGCCCCTATATGCTTTGGTCGGCGTACCAA
TCGATGCATTTGATCCGGATGGTTATGACGTTTTGCACTTCTCAATACTACCTGATGAGGCCAACGGAGTACCTTTCACAATTGATTACAATACGGGTCA
AATTCATGTGGCCGGAGATTTGGACTATGAGACTCAATCGTTGTATATGTTTGAGGTTGCTGTTGAAGACACAGCTTTAAACTCAGTGGTGACACAAGTC
GAAATTAGGGTTGTGGACATAAATGAGAGACCACAGATACACCGGAACTGCTTAGTTCGTGAAGACGGCACAGCTGATAACCGCTACGAAGAGAACCAGC
ACGTCTGCCTCCAAGTATATGAGGACGTGGAAGTTGGATCTATCTTGCATCACTTCGAAGCGATAGACCAGGACAGTGACCAGCGACTGTTTTATTCGAT
TGACGAAAATTCAGCTTCCTTCGCTCGGGTGGTTCAAGATACCGATCGAAACTGTAGCCTGTTATACAGTCGCGAGCTCTTTGACTACGAGAGTGCGCGG
GTGCACCGGGTGCAGTTAATCGTCACAGATACGGGGAAAGGCTTTCTTTCAGATACCGTAACCGTATTCATATTTGTTCTAAACGTCAACGAGCCCCCAG
TACTTCTTCAAGCGTCAGCGTCAGATCTTGTGCTATTTGAAAACTCTGCAAGTGGTCATATATTGGGCCACCTTCAGGGCATGGACCCGGAAGGAGACAA
GTTTGTATTTTCTCTACAAGATTCGCGTCCTATCGCTAATGCCATCACAATTGATGCTGATGGTTGGGTAGCAACAACGAAAGTAGCTCTTGACTACGAA
GCCATGAGAAAGGTGAATTTCGGTGGGCCTGAGCCAATGCTAACCATACGAGGGGCAGTGACCGCATCGGATAACACCTCGACAAATTTCAATTTTACAA
TTATGGTATCGGATGCACCGGAATCGCCTGTGTTCAGACTATCTTCATATGAGCTATCTGTTCATGAACTGGCCCCTGGAGGCTCGCTTATTGGTGTCGT
CCAAGCTACAGATCCCGATTTGAACGATACAATTCAGTATGGATGGAATATGGAGGATACTGCAACCTCAGATGTGAGCAGTATCTTTGCGATATCTTCT
GACTCAGGAGTAATATCCCTGATAAAGCAAGGGGTTTTATATGCAGACAACAATGAAGCTTATCAGCTTAGTGCACGTGTGACTGATTCATCAGGGTTAA
CGAATTCCACCAATGTGATTATCTCGGTCGTAAACGACAATGAGCCTCCAATTTGCCCGCCCTTTCAGTGTTGGATACTGGAAAATTCTCCTTTGATTAA
CAGAGGACTGCCTGGGACGCAAGGTTTGTGCCAGATAGTAGTGCAAGACAAGGATGCTGGGCAAAATCACGTTTTTCAATTGATTTCCACAAATGATAGT
CGATCGTTCGCGGTCGATTACGCCACTGGCGTAGTTCAGTTTGCTGCGAATCAACTTACTTTCGCGGATTTTGAAACACAAAGTCTGTATCGCATTCGTT
ATCAAGCGAATGATGTTCCAAGTACTGGTGCCTCACTCGCTTGCAGCAACGACATTGTGATTAGTGTTATTGATGTGAATGAAGCTCCAGCAATTTCTGG
AGAGCAGTCTCTAGTTGTGAAAGAAATGAGCGCACATGGTACGATCGTCGGATACGTAAAAGCCATCGACCAAGACTTTGGTGATATATTGAAGTTTTCG
TTGCAAAATGCGGACTCTTCACAGTTTAATATCGATGCAGCAACTGGGGTGCTAACAGTAGTCGACGATTACAAGATAAACTTCGAAACTACACCGTCGA
TCACCGTTAACGTTGTTGCAACCGACGTTGCAGGACTTCATGTTTCGGCAACGCTTCTGGTTACGGTTTTGAATGTGAACGATCCGCCAGTGCTACAGCC
TGTCAACTTTACAGCAAGAGAGTCGGTAGTATCGAAACCAGCCGCATCTACACACTCGCGAAACTTAGAGCAACTGGGGGTGATTCCTTGCTTTGATGAA
GACATCGGTGACGAGTTATATTTCAACATTCTTAACGATACGGCAGCCTTCAGTGTAGAACATAAAAGTGGAATTGTGTATGCGGAAACAGCTTTTCTTG
ATTTCGAGACACAACGGCAATATGAACTCAGTGTTCAGTGCTCAGATGGCCAAGCAACTGCGATTACCACCGTCTGGATATTCATTTTGAATATCAACGA
AGCACCTGTTCTCACTGGTAAAGCGTACCGCGTGTATGAAAACGCAGTAATTGGAACTAGCTTAGGCTATATTAATGTTTCCGATCCAGAGCACGACGAT
GAATACTATTTGACGCTGACCGAACCAGCTGGAGGCAATGCTATAGTGTCAAGTCTGAAAGAAAAAGGATCTGTATTCTCTGGCTCTTCTGATTTCGAAT
GGATAGACATTCCACCTCAGCTGGCAAATGCCTTCGTGATATCCACACCTACAGCAGTGTCTTTGTCGAGTACCGCGCTGTTTTTAGCGAGCCGAGGCAG
TTTGTTTGTTTTGGTCGAGCAGGATGCTGACCTTGTTCCAGAGTGGGTATCGAAGAACTCATTCATAAAGAGTGGCGGTCAAACTGCAATAGCACAAAGT
AGTGCAAGTGCGCTTATTTTCGATATATATATCAAAAAAAACGTCCTCGGGGTGTTTGAGATACCTGACACAACATCAACGAGCATGCTGTGCATTTTTG
GTGCGTATCCGGCTTCTTTAGATTTTTTTCTCCATGGTTCAAAGAGCGATTGGTTTGGTGTCACGGCATCTGGAGAGCTGGTTCTCACTAACCCGACGCT
CAATTACGAAGACATTGATTCCCGCGACCAGCCATTGCAAGTCGTTGTGATTGGTGTCGATAGCGAGGAGTTACTGGGAGAGGCCACATTATTTGTTTTT
GTTGATGATGTGAATGAGGCACCCATCCTTTCTGATAGTTATTTCGAGATTCAAGAGAATCCCGCTGTTGGTACCATGGTTGGTGAGCTTGTTGGTAGTG
ATCCCGACTTCAACGATCGGATAGCATTTCAACTAGCATTTCCATCACCAGACGTTTTATTGACGCCGGCTGGACATGTGTCTGTACGCAATAGTTCAAG
TTTTGATTTCGAGAAGAATTCATTGGTCATGGTTCGCATCCAGGTTTCTGATATAGCTGGTCTGTACAGTGACCGCGAAATTCAGATCAAAGTCTTGGAT
GTTAACGAACCTCCAATTTTCCAGCAAGCATACTATTCATTCAGCGTACCTGAAAATTCCATATCGGGGCTACCATTTGGAACGCCCATGCGTGCTATTG
ATCCGGATCGTGGTCAGACCGAGAATTTACGATATGAGCTGGTGAATCGAAATGCTGGCGGTTTGCCATTTCGGCTCGAAAGCTGCTCTGGGCAACTGGT
AGTACAGTGGGATAATCTAGACTACGAAAGTACCAATCGCTATTCCTTTGGCGTCCGTGTTATTGATTCAGGATATCCTGTTGCTCTGGAGTCGCAAGCA
ATCGTGGAGGTCACGATACTTGATGTAAATGAGGCTCCTCAATTCGCTCACTCTAGTTCTCAAAGTATACTAGAAAACGAACCTAATGGAACGTTTATCG
GGACTGTAGTGGCCTCTGATCCTGATAAGAATTCTGAGCTGTTCTTTCGAACGAATGCTAGTGATTATATTCGCGTTTCCGGGAACGGTGGGCTGTATTC
GATGGCTCCTTTTGACTATGAAACAATGCCAGTACTCTATATTGAAATTACAGTCGAAGACAATGGAGTGGGATGCCACATGCTACTGGAGGAGTCTCAG
TGTGGGCCAATTATTACATCTACTATTATTACTTTATCGGTCCAAAATGTCAACGAACCCCCCACTCTGCTGGCAGATATGTTCGTCATAAAAGAAAATC
TCTCTCCAGGGTCCTTAGTTGGAAGACCTATTCAAATCGTGGACGTTGATGGAGTTGTGGGGAGCAGTTATGGGTTTTTGATAAAAGAAGGTATTTCCAG
TGGAAACGAATCAGAGTTTTCGATTCGAAGTGATGGTCAGCTGCAAACACTTGTGTCTTTGAATTTTGAAGCAAAGCTCAGTATGAGCTGAAAGTAGCGT
ATTCTGACGGTGAGTATTGGTCCTATCTAAACGTTACAGTCACCGTACTCGACGAAAACGAGCCTCCTGAGGTTGTTACTGGCATCAATGGGTCTGTCCC
AGAGAATATGGCTGCTAGTACTAGTGTTTTAGTAGCAAGGTATGTTGATCCTGATCGCAGCTCAGACAATATTTTTGCCCTTGTGGATAGCTTTGCACCG
TTCCAAATTGATCCACAGACGGGGTCTTTGAAGACAACACGCTCTCTAGACTTTGAGAAGGACCCTACTCGCTTCAATCTTAACATAAGAGTTTGCGATG
CAGCGCAGACAAGTTTATGTGGAGTGGCTACGTCACAGTAACGGTTACTGATGTCCCCGAGATGCCTTTGATGAGTGATGTTACTTGTGTAATAGTGGAG
AATACCCCGACTATTTTGAACGAACAAGGCACAGCCGCGTGCACGTTTAGCGCTACTGATCCAGACAGTGCATCGTGCTCGTTCTATCAAATTATCGGGA
CTAGCGCACAATTCCAGTTGGTGGATGACACGACAGTAAATGGATTAGTCTCCGCAGGGGTTCTTGAATCGACTGTATGCATCAACGGTCAAGTGGGCTT
AGTTTGGAAAGGATCATCCCTGCCAGATTACGAAACTCAGTCTCAATATGTGCTTACAGTTCGAATTTCAGACAAGACAGTGAAAACAACGTCTCTATAT
ACTGAGAGTCGTATAACTGTGACTGTTCTCAACGCAAATGACTGCCCCGTGCTGGCTTCTTTAACATTCACGGTGAGAGAGCGATCCTCTGTCACCACTC
AAATTGGCTATCCACTTCCGGGTAAAGACCAAGATGTTTCCGATACTCTCACGTACAGCATCTTGGAGACAAATGCTTCAGCGGGCTTGATTCTAATAGA
CGTGCTGACAGGTCAACTTCGACTTGGTCGGAACCCTTTAAACGCCGAGCTGGTATACCCGGCTCAATACTACGTGAAAGTTGCTGTTACCGACACCAGC
TATGATCACTGTTCGGGTAACGGACTCATTCAAGTTCTAACGACAAAGTCAAACTTTGCACCTGTCTGGTTAAGCACGTTGCCGTCGTCACTCGTGATAG
CTGAAAATTCAGGGGCAGGAATGCAAGCGGGGGCCTCCCTATCTCATTTTGTCAGTGATCCAGACAGCGACCCAATTCAGTTTACATTGCAGTCGAAAGC
CGACACATACTGTTCAGACATGTTTATCCTTGGATTGGCAAATGGCGCTCTGACGCTTCGTGCAGGACGCACTTTGGATTTCGAGAAGAAACGCGCATTC
GTATGCACAGTAGCGGCATGTGACCCAGCACACATGTGCAGTACACAAGACGTCACTGTTCAGGTCATAAATGTCAACGAGGCACCTGTATTCAGTGACC
AGTCTTACGCGTTCCAGATAAAAGAGAATGAAGCGGTGAATCTAGCCCTTCCGCGTTGTATCAGTGCGGCTGATCCTGACGAAGGCGATGGTTATTCACT
TGCTTACACGATTTCGTGTGCAAATACAGCTGATTGCTCTCTTTTCGCGGTACAAGTTGAAGAGGACTATAGCCACGAGCTGTGTGCTAGGATTGTGGTC
AAACAAAGCTTTAACTTCGAGGTACGACAAGTCTACAGCTTCACTTTGATTGCTCAGGATGCTGGTAAGCTGACTGCGGTGGCTGGTATCACAGTTGAAG
TGGAGGATGTAAATGAGATTCATTCATTTATTGGGGTTCCAGCGACATATTCTGTTTTCGAAAATACGGCAATTAACTCGGTCTTGCTTCAAATCAAGAC
GGCAGACCCAGATATTTACTCTGACGAATTCAAGACAATTCGGTACGCGATCGATGTGTATCCACCAGGACTGAATGTATTCCGCATTGATGCTGCAAGC
GGTGATTTGATAGTAGATGGGCTGATAGACTACGAGGCTGTTCAAGCCTATACAGTGAGCGTTGAAGCTCGTGATTCTAGTGGTTTCAATGCGTTTACGA
TTGTAAACAGGTCGCGGTCGAAGTGGTTGACGTTCTAGATACTACTATTGATACGTTCAGACTTATGGATACCAGCTCCTCAGACCTCGATACGAAGGGG
GGTGAAAGGTTCTTACTCACTGGTTCAAACATTGGGTTCAAGCAACGAGCTGATAACTCAGTTGTAATCAAGCAGCTCATCGTGGAATATGGGGCGTATG
GAGCCACTGCACTATACCGCGCTACAAGCTGTGGGCTCGTTAATGGGAACACCGGAATTGCATGCACGTCAACGCCAGGTGTTGGCGCAAATCTATACTG
GAACGTTACTTTGGTAATGGAGGTCCCAACTATTGGAGAAACCGTATTCCAAGCATCCTCCTCGGTTCCCCTGGCATCCTATGGTGTTCCGGTTATAGGC
TCTGTTGTCTGCAACAGTGCGCTACCGACCGATGGTAGCAACACAAACAATATTAGGATTTATGGTGAAAACCTGGGGTCAACGCAGATAACAAGCGCAG
ATGCATATCTTGTCGTTGTATATGGCTCCGAATTCGAAGCCCAAAGCTGTGAGGTACGCGAAGATGCAACAGGTCATTATATCGCGTGTCGCAGTGTTGT
TGGTACAGGCGCTGATCTCGCATTCGTTGTGGTAGTTCGCGGTCAGGCCAGCACCGCTTTCGCATCTAGCTGTCACTATGCGTTTCCGACTATTTCTGAT
GTAACTGTGGCTGCCGGAATGTTGACCACCGGAGGTGACATCGTAATGGTGAACGGAGCTGGATACGGGTGTCAGGGATGTGGCAAAGTCACTGTGTGGT
ATAGTAACAACGTTCACTCGTTTGAGCTTGATGACTGTAAGGTTGTCATTGATCACGTGCAGTTATCCTGTTTATCTCAACCCGGAGCTGGAGGATTATT
CCGATGGCAGGTTTCCGTGGATGATCAGAAGAGTTACTCGACTACTACAATCACAACTTCTTATAAGGCCCCCGAACTCTTTGAAGTCATGGGCTTCAAA
GATGTTCCTACCGCGGGAGGAACGGTCTTTGAACTCCGCGGGGAAAACTTCGGACCTGACGGTGCTGTCTATACGGACCCCATTGTCGAGTACTCTTTCG
ACAATGTTACGATCCTTCGCAGTGTCAACTGCAAACGAAAATACAACGATCCGACCAATCATAATTTGATACAGTGTGTGTCTGTGGCTGGTAGTGGCTC
GTTCCACTCGTGGCGTGTCACCATCGAAGGCCAAGCATCCCTGTGGACTGCACACAACTCATCGTATGCAGGACCGATTGTGACAAAAGTGTTTCGCCCG
GATGGAGAAACCGAAATCAAGACAAGTGGGGATCAGCAAGTTGTTATCACGGGCAAGAACTTTGGCACCATCAATGCATCCACCATTTCGAGTGTGACAT
ATGGCGTCAATGGTGACGAGTTCACGGCTGAGGATTGTGCCATCGTGGTCGACCACGAACGGATCCTCTGTACGACCGCACCTGGTGTGGGCAATCGCCT
TGCTTGGATAGTCACAATCGATGGTTTAACCAGCGCAACGCCCACGATTAGTTATTCAAGACCATTTATCACTTCGATTGAGGGTAATGGGGCCAACGCT
CTAGTTCGCGGTGGGCAGGCAGTCGTTCTTCGAGGAGGCAATTTTGGGCCCAATACTGTAGTCATCGATGGAATTTCGTATGGAAATTCAGGAAGAGACT
ATCATGTGAAGGAAGTGCTCGAGCACAATGATTCCACAATCATTTGCACATCTGTTCCTGGTGTAGGGGCGAATCTATCCTGGATGGTGTCAGTCGGTGA
TCAAGAATCAAGATTGTCGACTGCCACGAGCTCATATGCACCGCCTGTGGTTTACTCATTGTACCCTTCCGTTGCATCAACTGATGGGACTACGGAGATT
ACTGTTATCGGAGAAAATCTTGGGGCGAACGTGCCTTTCGCAGCAGCACGCGTTGAGTTCACTCCACCGCAAGCAAGTTTGTCAAGTTATCGCATTCCTA
TAATTGGGTTTGGAGATTTTAGTGACAGCAACAGCAGCGAGTACATTGTGATTCGTGTACCGGTGGGTTATGGCTATGGTGGATCGCTGCAAGTGTTGGT
CGGTACGTCGAGTGTTCAAAGAAGTGCACCACAGCCAATTAGCTATGGGCCTCCGTTGATTGACTCGGTATCTACGGACGAAGGCCCCACTGAGTGTCTA
CCTTCTTGCATCCGACTTACTATTACTGGAAACAATTTCTATACCTCGGGGCGCGTGATAGTGTCAAAGTACCTTATCACCGCAAGCAACCTAGAAGGTG
CTAGCTATGAATCTTCAGTTGAGGTTTTGTCTTGGTCTCATAACACCATCATAATCCCGCAGTACGTAGGCCGTCTAGGATACGTGACCATTGTGATTGG
CAGAGAGAAGCTGCTGAGTAATTCTGCGCCGTTCAGCTGGGATGATCCGTCCATTCTCGACTGGTACACACTTAGCTCGACCTGCGGGGTACTGGATTGT
ACAACGAGTCACCGATTGGATGGCAACACGAGCTTATTCCGAACAGTAGCAACTACTCCCGTTATGTCGGGGGTGTTTAGCTACCAATCAGCAACTAGTG
GTGGAGCTACACTAAGTCTATACGCGAAGTATGTTGGCCGTAGTCCCCGGGTAACAGTGGGTGGAAACAATTGTACCAATGTCGCGGTGAGCACTCCGGT
CATCCCTTCCAGCATACTTCTGTCTGGGGGGGTCACAGGGGTGAGCAATATCCGCCTGATTTCGTGCACAGTGCCGAGTGGTCAAGGCGTCATGCTTCCA
CTTCTTGTAACACGAGGTATAACTCTAAGTAGTCCACGGTATTTGAGTTATATTCCGCCAAACGTGGATTGGGACGGAAGCTCTGCCACTTCTGCTTCTA
CAACCGGAAAGGTTGTTTCTCTCGTTGGATCAAACTTCGGTACCACGCCAGTCATTTCGATGACTGGGAATTCCAACAGAACTGTTTCACTTGAAATCAC
GTCGTATGATCACTCGCGTGCTACAGTCACTATTCCTCCTGGGGAAGGGCAGAACTACACAATAAAGTTGACCGCGGGGAACCAAGAAACTGCAACGGTG
TTTTCCTACAACGCCCCTGTGATTTATAATGTCGAAGTGGTTGACGCTACCACCGAAGGTGGTTCCTTGATGACGATCCAAGGCGAGAATTTCGGGACAA
GCGAGCTATCAGGCGCTCATACCGTTTTAATTGGTGATATTTTTTCATGCACAATCAACAGTGTTAAGCATGCAGTGATTACTTGCATGACAAGCGAGGG
CCAAGGAAGTGGCCATACAATCGTAGTCACTGTCAGTGGTCAAGTTAATGCTGACAAGAATGTGACTTTCAGCTATGACCCCCCGCTCGTCTACAGCATT
AGTAAAAGCAATGGCCCGACCTCTGGGTATTCCTGCAGCTGCACTGATCCAGACCGTCCCTGCGCAACGCTTTTGGCACCGTTTGAGTGCAATTTCCGAA
GCAAGCTCAACTACCACCGAGCTTGGCAGCTATTGCGTGGAAACACTGCTAAATGGGGTGTTGCAAAAAGTAACAGTCACTGCAGAGGCAGATGTGTACT
CCAGCAACAAGCCAGTGTACATGAGTGATGTAGCGACAAATGTACAGCTGCTATTCACCGGTGGGGTTTGGCAATTGTTACAAAGTGATGAACGTATTTA
TCGTGCTAGTACCGCGACAGTGAACCCAACACCTGCAGGTTGGCTCAATGTGATGGTGGATCCACCCGTTAGTGCGGTGGCTATGAAAGTCAACCCGGGC
ACTTGCTCAAAGGCAGCCTCACGTGCCTGTCCTGCAGAAACGGAGCTGTGCGAGAGAGTAGCTATCACACTTGCCGGCAAAAACTTTGGTGTCCAGACGT
TTGATTGGCACCTCGAGCTGGCCAGCACCGATAGCGTGATGGAATCGGTGAATATTACGAGCGATGACATCGTGTACTTCAGCCATTCAAACATCAAATT
CAACTTGCCACCAGGACAAGGCATCTCACGTATTGTCAATATGACTGTATCAGGGCTTCAGCTTGCGAACAAATCAATCGCATTCGGCTATCAGAGTCCT
GAGCTGATCGGCTACGAAACCAATACGACCAACTTGTCGACTTGCGGAGGTTACACCATCTCTCTTTACGGTAAAAATTTCGGATCAACTCGTGCTAAAG
TGCTTATTGGTGGCCGGGATGCACGCGTTGATAGCCAAAGTTCTCACCCGAGGGCTTGTGGATCCGACACATGTGAATACTCGACCAGCGGTCCCTGTAT
TGATACTGATACGTTTGTCTGCTATCCATCGCTGTACGTCGTGAGCCCTACGTTTGGTTTCCTTGAGGTCTGTAACGACACTACAGGGGCTCAAATGATG
TGTGAGACAACAGATCCTGCACCCGATGTGTCTGAAGATTTCACAAGCCACTCTGACTTTGTAATTGTGACTAGTGTGCCTGCTGGGTATGGTGCTGACG
TTTTGGTCTACGTTATAGTTGACAACCAATCCAGTAACGCCTTAACATTTTCGTACAATCAGCCCGTCATCACTGCTCAGATGCCAAATCAGCCCGATGC
AAATGGAGCCAACGCTATCACGATCAAGGGTACCGACTTTGGTTGTTTCCCCAATGATGCAATTACCATTTATTTTGCTGGCTCGGACGATACGTCAGAT
ACAGTACAGTCAATATCCCGCAAATTGAGTTCCCCAGGCATCTCCTACTTGCCAAGTATCTCGAGTATTTTTGAAGACACGTCTCATCGGCAGTTAGTGT
CCGACAGTTCAATTGCCTCCACAAACGTATCAACAGAGAACTCAACCGGGACCGTAGTCTGGACGAGTGCCTCAGAATTGGTATGGTATCCACCCAAAAC
GAAGGCTGGTGTTACGAGCATTATTCTGTCGGTAGGTGGCAACGTGATGTCTGCTACCAGTCAAACACAGCTGAAGTTTCAATGCAGTCCAGGTTACTAC
CGAACTTCGACGGAATTCTGCGACGAGTGTCCAGAGGGGGCTACTTGTGCTGGTGGGGACGAGATGCCGTTAGCCAAACCTGGCTACTGGCGTGAAGGTG
AGGTTGTCCTCGCATGCGATCCCATGTATGCGTGCCTAGGTGCCAACAAATGCGCGGAGGGTTATACTGACATAAGGTGCGGCGAATGCGAGACAAACTA
CCACAAGCTCAATTCAGAGTGCAACGTGTGCCCGGAGAACAAGTGGGGGTCAGTCGCAATTGTGGTCGTCTGTATTAGTGTTGCATCCATCGTGAGTTAT
CTTCTTACTCGAAAAGGAGTGAGCCTTGGTCTACTATCTATCGGTATCGATTACTTCCAGACACTCTCCATCTTCGGCAACGCTCGTATTTCGTGGCCAA
CGTCGTTGATTAATTTATTCGCGACTCTGTCTGCATTCAACCTCAATTTGGAGCTGATTGCACCCGAGTGTTTTTCACTCCAGGTCTCGTTTGTGAATAA
GTGGTTCATCATCGAGGTGTTCCCACTTGTCATGGCGGCCACGGCGCTCGGGGTCTTTGTAGCTCTTTACGCTTACAAACGCTTTATAAAGAAACGACGC
ACACGTCTAACATCGCACCTGCCGCAGCTTTTCGGATCAACGCTTGTGATGATGTATTATCTTTTCTTGTATCTCACACGAACGACATTGGATATCTTCA
ACTGCGTCGGATCGATCCCGTCGGACGGAAAGCTGTACATGGTGGCCATTTATACTCAGTGCTTCAAACCAGGCGGGTTGCACATGCAGCTCTTCCCGTA
CGCAGTGCTGGCATTTGTGGTATATTCGCTGGGCTATCCACTCTTTGTACTTCTGACGTTGTCTCGTAATCGAGCGTTGGTCATGGAAGATCAGCTTCTA
CGGGCTATGCAGAGAGGAACAAGTCGCCGAACCAATCCAAACTGCTGGGTGTTCCGCAAGAAGTTTTCAAAATTGTATTATCAATTCAAGCCGGGCTACT
GGTACTGGATGGTGCTCATTATCCTGAGGAAGTTCCTACTCGCAGGTATCGGGCTTCTGTTCCGTCAAGACCCAGTGTTCCAACTGGCAACAGCGACCTT
TGTATTGTTTGTGAACTACGCGCTACAAGTACGCTGCCGCCCATACATGAGTGTCTATGAGGCACAGCGGGTCTTAGCGGACTATGCCAAACGAGTCCTG
TTGGAAACTCGGCGTGCAAAAGCCAAGGGAGAGGCATTCATTCAACCAGCTCACCTGCGTCTTGAAATGCACGCTTCGACGGTAACTGCCTGGAAGAGCG
GCCATGGTGACCATGGGGGTAATGGTGTGACTGGTAGTTCTGCTCCGCCCACTTCAGGACTTCGTGGAGCTAATGAAGCCATCCTCGCATCACAAGAACC
GCAGAACGTGGTCGGATATCTCTGGGATCACAACACAGTGGAGGCGTGTCTCCTGTTCAGCGCTTCTCTCGTGTTACTGGCCGGCGTAATGTTTGAAAGC
GGTCGGCTTGGAAGTAACGATACTGGATTCACGAGTACTTCGGCACAAATGCTGGCCGTTGCCACCACACTTCTTGTAGCCGCAAGTTGTGTGTACTTTG
CACTAGTTCTGATAACAGAGCTTGTTGTAGCGCTTCGACCCGACTACTACAAACGTATTACTCGGGTGCAGAAAGTTTTTAGTCACTGGCATCGCAACCA
AAAAGATAAAGAGCAGGGTGGAAAGCGTGGAGATGATGACAGTGACGATGACGACGACGACGAGCTCGAGATGGTTGCGACTATGACACAAAATCCGCTG
CAT