Description :
From Genome Similarity Track
Location :
contig_149:5284- 7160
Transcript NameFunction/comments
g14347.t1hypothetical protein
g14348.t1hypothetical protein

Sequence
1876 bases(100 bases per row)
AGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTAC
CCATTTGTACTGGTGACTCCAGTAGAGGCACGCGTGAGAAGCAAGTAGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGT
GATCTTGAGCTTCAGCTCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACA
CGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGG
CCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGA
AAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATG
TGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACT
TCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATC
GAGTTGCATCAGTGCGCATCCGATCGGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCA
AGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGGCGACAGCGGGCGAATCTTGCCGC
GTAGTTGCTCACGTATTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCT
TTCCTGGGTCAGGGCGTACGCCGTTTCCCCCCACGAGACACCCAAGTACGGGTATCTCGGTCACCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTT
GTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCGGCTGTGAATGAACACGTCGTCGA
AATAGCTCGGTGCGAAGTCGCGCACCGGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGGCGTTCTTCAGCCCCTGCGGCAGCACGAGCCA
CTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCGTGAGAGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAA
GATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGTCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACG
ATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGA
AGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGCCGCGTGACGCAGTACTTCGTTCCCCGGCACGAGATCAATCTCGTGCTGAACACCCT
TATCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCT