Description :
From Genome Similarity Track
Location :
Scaffold_1068:5284- 6410
Transcript NameFunction/comments
Phyag_g9348DEAD/DEAH box RNA helicase, putative

Sequence
1126 bases(100 bases per row)
CCCGACTTGAAGCTAGCCAGAGCCTGCTCACGCTCACGCTGCGAGCGGTCACCGTGGATCGACGTGGCCGGGAAACCTTCACGGCACAGCATGTCCTCCA
GAAAGTCGGCGCCACGCTTGGTCTCCACGAACACGAGGATCAGACCGTCCTGCACCTGGTTCAGGAAACGCACAAGGTAGTCCTCCTTGTCGTACTGCTC
AATGTACTCCACCGTCTGCTTCACATCCTTCGAGGCCGAACCCACACGGCCGACCGTCAGGAAAATGTAGTCGCGCAGGAAGTCGGACGCGAGACGCTGG
ATCTCACGCGGGAACGTAGCACTGAACATGAACGTCTGACGCTCACGCGGCATGCCCTCCTGCTCGACAATGCGGCGAATCTGGGGCTCGAAACCCATAT
CCAGCATGCGATCAGCCTCATCCAGAATCAGGAAGCGGACGCACGACACTGAGATGCGGCCACGCTCCAACAGGTCGATAAGACGGCCGGGGGTGGCCAC
CAGCAGGTCGCAACCGCGCTCTAGCTCACGCAGTTGGCGGCCAACCTCAGCACCACCGTAAATAACAACGGGGGCAACACCCGTGCAGTAGCAGAATTTT
TTAGCCTCGTCGTGGATCTGCGACGACAGTTCACGCGTGGGCGACAGGATCAGCGCCGCAGGGAAAATCTTACGCGAGCGGCCATGGCCGACATCAGGCG
GAGGCGTTCCGCCCACACGCAGCATTGCCGCCAGGGTGGGGAACAGGAAACCGCCGGTCTTACCGGATCCCGTCTGGGCACAAGCCATCATATCACGGCC
TGCCAGACCGATCGGGATCGAGTACTTCTGCACGGGCGTCGGCTTCGAGTACTTGCACAGCTCCAAGTTGCGAATAACCTCGGGGCCTAGCTCCTCCACC
GAGAACTCAGACACGGGCTCGGGCACGTTCTCGCCGCTCGTCTCCACGGGAATGTCATCGTacttgtcgaagttgatgCCCGACGACTTGGCGTCGCCGA
AcagctcgcgctcgagcCGTTCGTTGGGGCGCGTGTCTCCGTGGTAGCCGATCTCGTTCACGCGGGCcgcgccgcctccacggCTGTatccgccgccgcc
gccgccgccgtaACCTCCGCCGTATC