Description :
From Genome Similarity Track
Location :
Scaffold_777:5283- 10265
Transcript NameFunction/comments
Phyta_totarag10676hypothetical protein

Sequence
4982 bases(100 bases per row)
GAAGCCGCCTCAGCCTAAACCGTTGAGGCTGAAGATTCAGCCCTATGAAGGGAAGGAAGGAGAGAACCTCCATTTCTGGATCCAAGATGTCGAGCTCGCG
ATGGACGCGAGTCTTCTCTCGGACGAGCGACTCCGCGTCGCTTTCGCGTTCTCTAATCTTAGCGGTCGTGCGGAGTGTTGGGTGTACGCGCGTGAAGCTG
TGTCGCCTGGATGCTTCGCATCCTGGGCTCAGCTGTGTGAGCAGCTATGAGCCGCTTTCCTTCCGGCCAACTACGTGTATCGCCAGCGCTCACGCTTCCT
TACCTGCAAGCAGAGGAAGTGTGAGCTGCATGAATACATCCAAGAGATACGTGTACGCCGCATCTCTGGTAGGCATTCCCCTACCTGAACCCATCAAAGT
GACTGTGTTCATGAATGGCCTAAGAGCAGGTCCGGCCCGCACGCAGCTGTTCCGCGTGCAGGCCGGAACCAGGGAGGCGGCTGCACATACAACcctgcag
gaggaggagagtCATAAACCGCTCGTACTCCCATCGTTGCGTGGCACGGTAACTTAGTGCCAGGCAGTGCGCAGAGCAGTAGCCCCGGTAGTGTTGCTAC
TAGCGGGCCAGTTCTGATGGATATAGGCCTGGCCGAGCAGAGCGATATTCGTTGCTTTTTTTGGATGCGGTAAGATCGGACACATGAAACCTTCATGTCC
TGCTGAAGGACAACGGAAGCAAATCCCTTCCAGGCCCTATGGTTCGAAGGGTCGCTGGCACAAATCGTGACCAAGGGTCCATGGGAATACCGGACATCAG
TAGGGTGGGGCTCCCTACTCGGTATTAACAAGTCTTCGTGACAGGTGTGCTGGTAGCTTACATCACGAAGGTTTAGCTCCTGAGAGTCTCGGAACTTCTG
AACCGAAGAAGGGCAGCGGTGGGCTGCTTGTGGTACATGGAAATGTACAGGGACACAATCATTCCTTTAGAGTCTTGATTGATTCTGAGGCGTCGAAGAC
TTTCGCGCGCCTCCAGTCGGTCGCAATAGCAACAAGGTTGCCGACACTCTGTGTGAGAGTAAGGGCAATGGGCTCGTCTCGGTACGACTAGCCAATGGAA
CGGTAGTGGTAGTACCCAAGGTCTGCATGGACCTGACTGTTAAGTTCGATGCCTTTGACAGCACTGAACAGTGCAGTATTTTGAcatggacgagttcgac
tTGATCATGTGCATGCCCTAGGTTGAGAACCACGAGCCCGGATTGAATGACGCAGCAAAGCCATTGGGGCTAGCCGGCCCGCCGTTTCTGACAGAGCATT
GGTGAGTCGTGTTCCTGCCTCTGGCAGGAACCGCCAGAACGAAGTGGCGTCCGAAGCGTTTATGGGAGTCACTAACGAGGTTGACAGATCCATGGAATCG
GTTGCAGAGAGAACTGCAACAAGTCAAGAGACCACGTCAATCGCGGATAACCCTCGTGACCGACAAAGGCTAAGCCGGTGGGCAGGGCTTCGTGCCCGGC
GTGTGGATctgcaacgccagcagcttccaacGCTGAGAGTCGTCGCACCATACGGGCTTCGACTCTAGTAGTGCCGGATGGCTCTAACCAAGTAGGTAAC
ATAGTTCCACTTAACGCCAGGAAGACCGGAACAACAGAGGAAAACGCTGAAGGCGCCTCCTGTGTGGGTAACATAGTTCCACACGGAGTCGGGAAGACTC
CTGATGCCATCAGTAAGGCATCACTAGACGTGGGTAACGAAGTTCCACGTCGTGGTTGTCACCAAGAACACCGAACATCGCCGTACGTCGGGTCTGGGAG
AAAACCAGACAGGGGTCGCCGTGAGCTAGTCGGAGCGAAGGGCCCATGCTCCTCAGACAGGGCCGACCGAGGAATGTTATCACACCTTTGACGGCGAGAT
CGGGTGTCGGGTCAAGGCAGGTGCCGTCCAGCCGGAGGCATGTCAGAGTTGCTGAACCTCGAAGAGATGTCGATGGAACACTTCTTGGCCGAGTTGAAGG
CCGAGGAGACCGCGAAGATGGTGCTTCTGCAGCCGGAACCATCTCCTGAGGGATTCAATTCCTCCTCTGGCATGGACGAGGATGTCCTGGACGTAttccg
gcagcagcgcgcgtCGCACTTTGGTTATGCGGTTCTCTAGAACCCGAAGGATCCGACGTATCCTTTATGAAGGCGGTTGCGGACGTGGTGTCGAAGAATC
CATCGTCCCAACTCCCGCCGGATCGGGGCATCAGACACGATATTGATCTCATGCCGGGCACAACGTACTGTGTCACCAGACCATGGCCCTGCCTCGCGAA
CAGTGCGAGGTCATAGATGCCTTTTTGTcacgaagtcgaagccaGGCATGGTGCGGGAGTCGAAGTCCCGCACTGGACGCAAAAAAATGCTGCGTTCGGA
AGCCGAACGGGAAGTGGGGTCTGGTTCACGCTCCCAACAAGCTGAACAACGCGATGGTGCCGGCCCACTCACAAATTCTTCGCAAGGATGTGTTGTTGAA
CAACATGGCCAGCTGCACACTATATAGCACATTGGATCTGGTGGATGGATACTACCAGATCGTAATGCGTGAGAGCGACATCCCTCTCACGGCAGAGAGC
ACGCCGAGCGGTGTGCTCTGGGAGTGACTGGTAATGGTACATGGGCTCTCGAACGCCCCAGCGACTTTCAATCGCTTGGTCGCGCAATTGTTTAGACCGT
TGGGTGCGTTCTCACAGATGTGCTTTGACGATATTTTCGTCCACAGCCGTGCCGACGAAAGCAAAACGGATATGGAGGTGCAAATGGAGCACCTTCGGCG
AGGTTTTGAGGTCATGAGAGCCAACAAGCTCGATGTCAACATCGACAAGTGCGTCTTTGCGGCGGAGGAGATTAAGGTCCTCGGTGGCTTGGTCAGCAGC
GTTGGGGTCCGTGCAGACCCGGAGAAGGTCAAAGCCATCGCGGCTTGGTCTACGCCCAGATCCCAAAAGGATCTTAGGAAGTGGCTGGACCAACTACCTG
CACAAGTACAGTGCAGGGTTCGCCGGCCTTTCGCGGCCTTTGTCGGGTCTCTTGAAAAGGATGCCGACTGGCGCTGAGAGGGCCAGTACCAAGCAGCGTT
TGATCGCATCAAGGCGAGCTTATAGCGTGCGCCTGTCCTGGTATTGCTGGATTAAACGAAGTCATTCCGCGTCGTTTGTGACGCTTCGGACTATGTAATA
GGCTGCGCAATGTTGcaggacgatgaggatggaCGAGCGTGTCATCTCGTTTCAGTCCAGGCAGGTGAAGTCTGTCGAACGGAATTACCCCGTTCATAAC
AATAAGCTGCTTGCAATGAAGTATGCCCTTGTCAAGTTCCGGTTACATCTCCTGGACTCGAGGCCCATTGTGGTCTGCACGAACCACGCGTCCTTGCGGA
CAGCCACCAACTCGCCGCATTTGTCGCAGAGGATGGCACGTCGGCTGTCATTCTTCGCGGAGTACAACTTCCGCGGCGAATACAAGCCGGGCAAGCTCAA
TGTGCCCGTCGATGCGTTGTCACGCAGACCCGACTATGAGTTGGCACACATAAGTCGGGTCACGACAGATCTATATCATCGGATACGCATGGCGTATCGG
GACGACGAGAGTCTTGCGCCCCTCATGCGGTTTCTAGCCGCTGACACGGATGCCAAGGTCGAATGGATGTCGCCTCGACAGTGGGCACGTCGCCACCGAT
ATGGATGGACTGGCGGCCAGTTCCACTATCGCGTGGAGCCCGGTGATCCTCCTCGAGTTGTCGTTCCGAACGACGAGGATCGGAAGTATGGTATACTTCT
AGAAGCGCATGGTGCGCCTTCTAGCGGCCATTTGGGTCGCGAGAAGACCTTCCTGTCGGTCTCTCAGACGTTTTAGTGGACCTACTTGTACAAATGGGTT
GCCACGTACGTGAAGACATGCGAAGCCTGTGGTCCACGCTTTGGCTCCTATACAAAGCCTGCCAGTGCCGGAGGACTGATAGAAGTCGATGAGTCTCGAC
TTCGCCTTCGGCCTGCCGGTCGATGACCAGGGAAACACCGGCATTTTGGTGTTTGGGTGCCGATGGTACACCTCGCCCCGGTTCCCGACTGGGTATCCGA
TGAACAAGCCGCACGGCTGTTCCTTGATGGCGTGTTTCGTTATCATGTTCTCCCAGAGACCATTTTCTCCGATCCAGACCGCGGTTCACCGCTGCGTTCT
GGAGAATACTGTTCAAGTTGTTAGGAACAACGTTGCTCATGTCATTCGTGGACCATCCCCAGTGGGCCAAACGGAGCGCGGTAATCGAGTGATCGAGGAC
ATGTTGCGTAGTGTCTGTGCTTCGGCACCACACACGTGGTCCGGGCGGTTGCCCATCGTTGAATTCGCACTCGACAACGCGGTGCACGCGTCGACGGGGT
TCACGCCGTTCTACATTGATGGGTTACGCCACCTCAGGGTGCCACTCACTTTGCGTGAGGCACCGAGGCTTCTGTCATAAGTGGGGGAGAGGATCGAAAC
GCGCTTTCCTCCCAGGTCTTGTAAGGGAGACCAGCCTCCCTGCGGAAGCAGTTGTCAGGGTTTATTGACAACAGGCTGTATATAATCAGCCGGGTTAGAG
ATGCAATGTCATCAGCCCAAGATAAGCAAAAGGAGTACTCAGACAGACAGGAAATACGAAATGTAAACGTGTTTAATGTGGGTGAGCTAGCCCTACTAGC
CACTAGTAACTTATCACTAAACACGTTTAGCTCCGTGGGGAGTAACAAACTGAAGTACCGCTTCATTGGCCCCCCTCGCGTTCCTGAGTAGTCACCGCGC
TGCCTACACCATCGACTTGCCTAAGTCGATGACGACCTACCCGACGTTTTATGTGGGTCGTCTAAAGCTGTACGACCCACAGGATCAGGCTGCCCCACTG
GGAGCGGAGGGCGGTCACGAAGAGGTCAGGGTATCTCCTCGAAACGAGACTGGGTCTCAGGCGCAGGGTGCCCCGCAGAAGC