Description :
From Genome Similarity Track
Location :
Scaffold_96:52827- 53899
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_96-snap-gene-0.24Actin

Sequence
1072 bases(100 bases per row)
TTCGCATCAGGCCGCACACGCGGGATCGTGGTCGAGGTGGGTCACGGCTCGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNGATCTTCGAAGGCTACGCAC
TGCCGCACGCGGCGCTGCACTACAACGTGGGCGGCATGGACATCAGCCACCGGCTGCACAAGCTGCTGACGAAGCGCGGCCACTCGTTTCACTCATTCCA
GCATCAGACGATCAACGAGATCAAGGAGTCGGTCTGCCTCATGGGCTCCAAGCATGAACGCGCGGCCATACCTGCCAGTGGTGGTGGCCACCACAGTGAC
AACAACCATTCGGACGACGGCAGCAAACCGTTTGAACTACCGGACGGCACGATCCTCCAGGTGGACAGACTCATGCGCACGATGCCCGGCGACGTGCTCT
TCCGGCCGCAGGAGCTCGGCGATGAGCACCCGCTCAAGCCTCCGAAGGGACTCCACGAGTTCGCCGCCGAGTCGATCGCGATGTGCGACAAGGATCTGCA
GAAGGACCTGTGCGGTGCGGTGATCCTGGCGGGTGGTACGACCATGATGCCCGGCTTCTCCAGGCGCTTCCAGGAGGAGCTCGTGGGCGTGACGAAGCAG
CATCACGTGGGTGGAGGCGGAGGTGGAGGGTTGTGTATTGTGCCGGACGCCCATGTCCGTGAGCGAGGATACAACTCACAGCGCCGCATCGCCGCGTGGG
TCGGCGGCTCCATGCTCGCGTCGCTGGGCACGTTCCGCGACATCCACATCACCAAGCAGGAGTGGGAAGAGTACCATGAAGCCATCCTCGATCGCAAGTG
CTTTTAAAACACATGCACAGGTAGGAGTCGTAATATCCAATACGATAGGATATCATTTGCAACATCACATCATATATATATTCACTCAGGTATAATTAAA
AAAAAGAGAAGACATCATTACCACCACCACGAAGAGCTACGCTGCCATCTCATTACGCTGGCAGCGAGCTTCGTGGGCTGTGACTGACATTGTACAGATG
CGAAGAGCAGCGAGTCATTGACTAGAGCGCTCGGTGGTCTTCATGGTTTGGCTTGGTTTAGCAGCCGCACGG