Description :
From Genome Similarity Track
Location :
Scaffold_1779:5282- 6550
Sequence
1268 bases(100 bases per row)
GAGCACGACTGAAGAAAACTTGGTCCGCATTTCTTGCGACGGCGAGGCCTTGTGTTTGGTGGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTT
CGTGCAGAGGCGCAGTCGAACGTGTCGATCAGGTAGGCAATATCTCCTCGATGATGATCGAGCCAGATGAGCACATCAAGATGGCCTCTTGTAGCTGCAT
TGAAGAGCGCTTCAGATGTGAACTGGGGCGATGTGTTGGCTTGCATCCACTCGATGACAGGTAAATGCCCATGGAGAGCAGCCACATTCAGGCCTGCACT
GGTGCAACCCTCCGTGCGGTTTGCAGCAAGGTACATGACGACGTCCAGGTGACCGTGGGATGCCGCGCGGTCCATTGCAGCAGTTGTTGCGATCGCAACG
GCTTTAGCCGTTGCCCACAAGATGAACTCCATGTCGCCTCTTCCGGTAGCTGTGTCGATGCAGACGCGCAAATTCGTTGACGATCGTGCCCACAGAGTCT
TGGCCATGGGTAATTCAGCACATGAGATAGCGATCTCCATCGATAGCACGTCATCTTCTGAAGCTGCAACCACCCAAAGCCACTCAGCCATTTCAACGTG
GCCCCGTCTAACTGCTGCTTCAATGGTGTACACGGTTCGCACCACCAAGGAGCGATTGCAGAGAATGCAGAGAAACTCAACAATCCCAGTGTGGCCACTG
GCAACAGCTTCCTCGAGCACACTTGCCGTCCAACAAACCCTCGATTGCTGCTCGTGAAGCCAGTGCATTATGTGCATATGGCCTCCGCGAGCGGCTGCAA
TGGCCGCGTCCGTGATCACCAGCCCCGGGAAGTGCGAGATGAAGTCCTCCAGAACCCATAGTCGCCCAGATGCAGCGACCACAGCCATTCCTCGGTTACA
GACAGCGGCGATGAAACGCATGTCGACGAGTTGTTGGAGTACACGAGCCAGCACGATCTTGATGAGTCTCGGGCTTCCTCGCTCACTTGCAGTTTGGACT
GTCCACGAAGGAGGAAAGTACTTGTTGACGAGCTCAGCGACGTGAGGTAGACCGGTGACCTGAGGGTGGTTTGTGCAGACGACGGAGACAGATGTAAACG
CCGCCAACGGGTCTTCTTTGTTGGGATACGGTAAGGCGGTCAACATGGGTGCTTCAGGATGAATTGCGTTATGAGCGACCGACCTGTTGGGAAACCGAGA
GTTGCTTTCTTCTCGACCACCTTCTCTTACAACATTTTGTCTCTTCGAATGCGGAGAAACTGGAGTTG