Description :
From Genome Similarity Track
Location :
Scaffold_159:52818- 55569
Sequence
2751 bases(100 bases per row)
GTATGGCTTAAGCAAGCCAACATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCCTGACCACGACCTTGAAC
GGTCCTATGAACCGAGGTCTCAGCTTCGTCTTGAAGACTGCAGACACTGCATAAGTAGGTAGGTTTTTAGCGTTTAATAAAACTTGGTCACCGACCTCAA
ACCTCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTCCCTTCTGCGTGTCTTGGCTTTCAGCCGTAGCGTCGCGTACTTGACGCATTACGCTCAGTCT
CAAAGAGACAAAGTCATCGACTTGCTTGCGAGCCGCAACAGGGCTGACACCAGCTAGCCTCTCGGCTATCCCTTCCCCATCAAGCCCTGAGCCACTGCGT
GGCGGCGTCAGTGGGACGCGAGGGTTAACCAAGTTGTTCCCATAGATCGGAGTGCAGCCTGGCGAGGCGTGCACTGTATTGTTTAATGCGAACTCAACGA
GTTGGAGCATCTGGCTCCAGCATTTTGGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTG
CGGATGGTCTGCTGTGGACATGTCCAAACGAGTGCCGAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAACT
GCCTCAGCCAAGCCATGTTGGCGAAAGGCTCGGTTTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGTGTTCGGCACCGCCGCTAAATGAGCCATCT
TGCTCAATCGGTCTACAAAGACCACAATATCCGTGCTTCCCGCCTTATCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTT
GGGGATAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATAC
ATCTTGGGCCACCAGTACGTCGAGCTCACCGAGCCATAGGTCTTCTTCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGAT
ACCTGAGATCCTCATCATCAGGAACGACTACACGAGGGTTATCCTCAGCGTCGGTGCTGTAGTCCAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCT
CGCGCGTAAGCGCCCAGACAATTCTTGGTCAGAGTTTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCT
CCGCGTATCAAGTCAGGCACTGACGACGTCACTATTGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCC
CCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGTCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGA
CGCATGATCAGTAAAGATCACAAAAGGCCTAGAGCCTAGCAGGTGTACCCTAAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATTACCT
GGATGGTTCTTCTCTGCAGCTTTGTGCTGGCGAGACTGAAACGCAATCACGCGTTGACGCCCTTCGGCATCTGCTTGTAGTAAAGCACAACCGATTGCAA
AATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCTGGTAGCGCAAGGATCGGAGCCTGGAGGAGGCTCTCCTTAACAGCCCTAAAGGCTCC
GTCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCGTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTCGCGCTGTACTTGTGCAAGTAA
TTGGCTAAGCTTAGCCAGTTGCGTAAATCTTTTTGGTTATTGGTAACTGCCAGTCCACGATGGTCTTGACTTTGGCAGGATCTGCCCTTAAGCCTGGCTT
CCCAATGAAGCACCCGAGGAAAGGTATTTCCTCCGCGCCCAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCAAACACCCCT
CGCAAGTGGTCAATGTGGTTCATCACGTCTGACGTTCCGTGCTCAGCACGACTATGGACGAATATTTCGTCAAAGTACGTTTGAGCGTACGCCTGGTGGG
GTCTAAACAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATGACCAGCCACCCCCAGAGCATACCGCACGGAGTACT
CACCGCTGTCAGCGGATGTCGCTCGCTCTCATGAGCAATTGGTAGTAACCATCGAACAAGTCGAGCGCACTGTACAACGTACAGCCTACCGTGTTGTACT
GCAGAACAGCCTTGCGAGGAATCGGCGTTTGCGCCGTGATGGTGGCCGCATTTAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTTGGCTTTCA
GACACAGAACGTGTGTGTCGAGCGCGGAGACTTACTCTCACGCACCTTCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACCGCTCT
CTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTACCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGT
CTTTCGAGACAACGTCTCCATACTCCTTCGCCACCGGGTAGAATGGATCCG