Description :
From Genome Similarity Track
Location :
contig_31:52814- 54303
Transcript NameFunction/comments
g7106.t1XP_009536706.1 hypothetical protein PHYSODRAFT_527564 [Phytophthora sojae

Sequence
1489 bases(100 bases per row)
CGATGTGATCGTGGTTGGTGGCGGCCACGCAGGCTGCGAAGCTGCCGCTGCCGCCTCCAGAACTGGTACGAGCATTAAAACGCAATTGTGTCGGCATCTA
CTAACTGCAGGACTTTTTCGCAATTGCAGGCGCTAAAACTGCGTTGGTGACGCAGAAATTGGCAACAATTGGTGAAATGTCTTGCAACGTACGCGACGCA
ATTGCCCTTGATGGTTGTCGAATGACCCAATGAGTAATTTTTGTGTGTGTTGATTCTTTGCAGCCGTCCATTGGCGGTGTGGGCAAAGGCACATTGGTGC
GTGAAGTGGACGCCCTAGGCGGCCTCATGGGCCAAGTGGCCGACTCTGCTGGCATCCAGTTCCGGATGCTCAATTCGGCGAAAGGACCGGCGGTGAGAGG
CCCACGGGCTCAAATGGACAGGGATTTGTACCAGCAGGGCATGCAGAAAGCCCTTGAAACGCTGCCGAACCTCTGGCTGGTGGAGGACGGAGTGGAAGAC
CTCATGCTGGAGAAGGTTGGTCAGAGTGAAGAGCGGGTGAAGGGAGTGGTGACGTCCTCTGGTCGAGAAATTCAGGCGTCGCAAGTAGTAATCACTACTG
GTACATTTCTCCGCGGAATGATATACCAGGGGCCCGACATTCGCATCCCGGCTGGACGCCACATGCGGGACACGGACGGACTTGAGCCACCGGCGGTGGG
TCTCGCCCAGACGCTGGAACGCTGCGAGTTCCCTCTAGGTCGGCTGAAAACAGGAACTCCTCCTCGACTTGACGCACGCACAATCGACTACACGGGACTT
GAGATTCAGCCCAGCGACGATGTGCCCAAGCCGTTCTCGTTTCTGAACGAGCGTAAGGCTGTGCCGCTAGCAGACAAGCAGGTGGTCTGCCACGCAACGT
ACACCAACGAAGAAAGTCATCGAATTGTGCGCGACAATTTGCACATGCTGCCGCAGTACGATGGTGGGAGGGATGGCGAAGGTGTCGGCCCCCGCTACTG
CCCATCGATTGATGCCAAGGTCGTTCGTTTTGCTGACCGCTCGAGACATCAGCTTTGGCTCGAACCCGAGGGCTTGAACACGCACATCGTGTACCCGAAT
GGTATCAGCACGGCGCTGCCCGAAAAGCTGCAGCTCGAGCTGCTGCGCACCATTAAGGGACTCGAAAAAGTGGAGCTCGTGCGCGCTGGATACTCGGTCG
AGTACGACTATGTGGATCCGCGATCGCTGCACCCTACGCTCGAGACGAAGAAGTTGCCGGGACTGTATTTGGCAGGTCAAATTAACGGCACCACAGGGTA
CGAAGAAGCCGCAGCGCAGGGTATCGTGGCCGGCATGAATGCCGGTCTGAGTGCCATGGGACGAGAGCCGCTCGTGCTTGACCGTGCTGATGCTTTCACA
GGCGTGCTTATCGACGACCTGATCTCGTTGGGAACGACAGAGCCGTACCGCATGTTCACGTCTCGATCGGAGTTCCGTCTGCTGCTTCG