Description :
From Genome Similarity Track
Location :
Scaffold_901:5281- 9292
Sequence
4011 bases(100 bases per row)
CTCGACTTCATATTTACCAGCAACTTGGTCTGGTTCCCAGCTGTCCTCAGGCAGTAGTTCCTCATCGAAGTCGCGTCTTGCTTCATTAGTCGCGTCAAGT
ACCAACCGAGTGTTCAGTCGACTGTTGAATTCGTTGACAGCTTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTT
TCAGCTCGTACGCAAACTCTTCCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTTTTCGTCAAGCCCGGTTTGACGCGTTCCA
TGTACAGCCACGCCCGGCTTCCAATCTCGAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTC
TTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCC
TTGGCCATAGTGATGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACA
TTGCCCGCAACATCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTT
CTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCC
TGTGGGCGATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCGTA
TTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCC
CGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCG
GCGAGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATAACTTCACATGCTTCTCCACGTCAGCGTATA
AGCCGATCCAATAATAATCGGACTGAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTG
AATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCT
GATAACACGAACCGGTCAGCATACTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACT
TCTGCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGCTCCCGCTGTATCGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGTACAGT
CTTGTGAGGATGGTCTGGCAAATCCTGGCCGAATGAATCATCGGTGGACGTCTCTCGTCGTTCTTCATGCTCTGCTTGAGCTTTTGAGACATCCTCCGAG
TGTTCATCTGCAAACCTGACGCGTTCTTGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAATTCTACCAGCGATGATTCGTCTGGCCCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGT
CTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATC
TTCTCCGAGTATTCAAACCAACCTCATTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGATAGATCATCGGCGCGTTCTTTAGCCCGA
AGGGCATGCGTAACCACTCGAAATGTCCGAGTGTGCAGACGAACGCCGATACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGC
ATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAGCAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCAGTGATAGCATTCACCATC
TTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGTGATGCCCCTGAACTGTCTGAAAAGACGATCAGTCCCGCAC
GCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATC
GCATATCGCACCGTAGGCTGGCGGCGGTAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTCA
GTCGACAGCTC