Description :
From Genome Similarity Track
Location :
Scaffold_27:52806- 53904
Sequence
1098 bases(100 bases per row)
TTTTTATAGGTGGACCTCCGATGGCGAAATTACTCGCACCACAGACGACTCTAAAGGGCTTATCCGCGTCTGGCAATGCCAAGCGGAGCTCTCCAATCGA
ATCTTCACTGAATCAAGCATACACTTGAGTCTTAGATCAAATCCATTATTTGTCCTTTTCAAGGAGATCCAACATTGGTTTGGTTCGCTCTGCATAATTC
TTGCTGTAGTTATGCAAGTAATTACCAAGCCCAATGAATTAACGTAAACTCGTTACATGTCGTGGAGCTGGTCATTATTTTATAGCCTTTTTCTTTTATA
GGTCTTCTCTGATACATTTTCCCACGATGAAGCCCAGAACAGGTATCTTGGGGACCCCTATGATGCACTTTTGCAATCTGACGTACATTTGAAAGTCTTC
CAGAGTCTGCAACACAACTTCCAAAATGACGTATGTGGAACTCAATTTTCCTTAAACCTTCCTCGGACTTACTATGAACCAACCTTTCGTCAAATAAATG
GGTCTCGTAGGCACGGTGTGGATGCATCACATAAGCGACCACCCGGTTGACTGTCGATGGTAAGTTTTCAACCCTTGCGGCATAACTAGCCACTCCCACA
GCATACCGCTCAGGGTGCTAACTGTCGTCTTGGCTGCATCGGTCTCATTCGTAATAATCTGATATTAACCATCCTTGAGATCAAATGCAGAATTTTTCGA
ATTCCTCCTTGAAGTCAATAGGACATCTCCGCGGGATCATTTTCTGCGCAGAGATGGTAGCCGTGCTCAACTTATTGTAAGCATAACTCTGCGCCATTCA
CCTGTTTCCTTACGCACACGAAAGGATGGGCTGCAATGAGGCATCTTGCTACCACTTACATGTCCCGCCTTGGCTCGCTTCGTATAATTGGCGATGAAAT
CGACATGTTTCTTCGGCAACGGTCACTGCCTGGTCACACAATCCTTGGTGCCAGGTTCCTAGTCAACCTCGTGCCGGATACCCCTGTTTTCCGGTAGGCA
TTTCGGCACTTCTGTTGGAAACACACCACGGTGGTTCCATAGAACTTCGCAAAACCGACTGCTTTGTAATGCATGCAAGCCTTGAGCAGCGAATCGTT