Description :
From Genome Similarity Track
Location :
Scaffold_94:528- 6173
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_94-abinit-gene-0.39Histone acetyltransferase

Sequence
5645 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGTATCTTGTAGCTAGTTCATTTGG
CTATAGACTCCACCCGTTAGTTTTGCAAAAGCTTTCTTCGTCTTCGCATCACACTTGTTGCCGCTTAAGGTCGATATCTGGGGTCTTACAGTGATTTAGG
GTCCAAAAATTACATAACGTAACCTGATGGTTTACGTTATTTTTGGACCCTAAATTTGAGCTCTTTTACGAAATGATAAATGGGTTGCTATATAGAGGTA
TGGCTGTACTGTAGAGGTATTATATTCGGGATTAAGCTCCCTTGTGTTTCTTTATTCGGGACATAGTTCCGAATACACCAAAGCCATCAAAACCTGCCAG
AAACAAGTAACAACAATGATCGGAAGCCGCATCGCCGTGCCTGCGCTGCGCAGCGCCTTGGCGCCATGGACGCTCGTCTCCTCCGCTGCCGGTACGTCTA
TCACCATAGTGTGTAGAAATCCCTCTCTCTTTTCTGCAAGTGCATGTCGATTGCTCTTTTTAGAGCTCTCTATTTGTGAAACTACAACGCGGGAACGAAT
GTGCACCAACTTGACTCAAATGCTCGTCTTGTGTGTGTCGTGATGTTATGATCGCCGACAGCTCGCCAGCCAGCGTTCCTCAACAACGTCGCGTTCAACG
TTGCGCCAGCACGCTTCGCCAACGTGTTCGAGTCGCTTGAAGCCTCGTTCGAGCGCATCCGCCTAACGGAAGAGACGCCGATCGCCATGGAGCTGCTCAA
CCGCAACGCGCGCCGCCCAAAGAAGGTAAGCACGTCGCTTGAAAGCGTAATGGCTGGCTACGATGACGCTAAACTACCTATTCACTCCTCTATGCACCTG
ACAGGCGAACCACGGCAAGCGTCCGTGCTCGCACGTCCGACGACGAGCCAAGCGTCTCAGTCGCCGAACTGCTTAGATCGTTCCGCACTGCACCCCATCG
ACCAGTCGTTCACGAGGTCCCCGCCCATAGAGAGAGAGAATTTGAGCAACGCCATCAACCGCAATGCGTCTGAATCCCCCACGACGCAATACAAACACGC
AACAGACAGACGCTCACCACCACCAGCGGGTGCGCGCTTTGAAAAAACGAAAAGCTCACTTTGATGGTCTATCATTTGCCCCTCTTGCTGGTCTTAATAA
CTCTCTCGATATACATACACATTCCTGTTGCTTGGACTAATTCCCTATTCAAAAAAAACAAGATGCTACCACACATTCACCCTCTCTCCGCTCGCTCCTC
TCAACCTTGTCATGCGCCCATCGGCTCGTCCTCTGCGCTGCCGTTGCCCTGATCTTGGCCACCATTCTCGTCGCCGCCGCTCTGCATCTGGCGGTACTGC
TGCGTCACCGCCGCACGACGACGGTCGTCCATGAGCTGCTGCTGGAGTTGCAGCTTGCGCACGTGCTCGCGCAGGTCGTGGCAGCGCGGCACCTTGCACT
CGTACTGGCGACACTGGCGCGCATGCAGCTGCAGCAACGCCCACACGCGACGACAGATCGTACAGCCACCGTACGCACGAAGCTTGCATTGGGCGCCGTG
GCGCATCAGCTCTTTCATCTTCTCGCAGTTGGATGAACCACAGTTGCCGTCGGCACAACTGCTCGAATGCACCAACAGCTGCATGTGCAAGCGCACATTC
TTCGCGCGGTGCTCGCGCAGGCGGCGCTGCTCCTCAGTCAATGCTGCGCCGTTCGCTCCACCACCATTTGCGCCACCGCCTCCACCCGCAGCGCCGCTCG
TCGGGATCATCTCCAGCGGATGTTCGTGCTTCTCCTTCTCGTAGCATGCGTCGCACACGTCAAAGTCCGGACACGTGTGGCAGTGCCAGCGGTTGCCCGT
GACGATATCCTGCGTGCACGCATTGCACTCATAAATATATGCGTTCGGGTTTGGATTGCCTAAGTGGTACAGCGCCATCATGGACGAGTGCTTCGCGCGC
CGCAGCTCATCAAACTGGTAGTGGTTCCCCTGGCAGAGACTCAAGAACGCCTGGCGCGTGTCAAAGAACTCGCTGTCCTTCACTTCGTCCGGGTCCGTGA
TCTTCAGCGGGATGTTCATCTCGGTACGAGTCAGCACGTTCAGACGTGCCTGCAGCTTTGGCGTGAGCTTCGCTTTCTGGTAACACGCATCGCACAGCAC
AGTCTGCACCGTCTTCGGGTTCAGACAAACCTCAGTCTTCGTGTTGAGATCCTGCCACGTCACACCTTGCAGCACTGTCGTGTTGCAGACACGACAGCAC
GGGTGCAGCTTCACGACGAGGAAATCGTCCTTCATGGGCTCAATCACTTCGCCGAGCTTCTTCATCAGCGGATCCGTGATTGTGCGATCCACTGCCTCCA
GCGACGTGATCGGGATATCTTTCTTCGGTTTCTCTCCACCTGCTGCGCTATCGTTGTCCTCGTCGCCAGTGTCATTGTCATCGCCTTCGCCATCCGAGAG
GTCCCCGTTCTCGCCCTCGTTCTCGCCGACTCCGGGTCCAGTTTTCCGTCGCTTGGTCTTCTTCGCTTTCGACTTCTTGCTGCCTTTCTTCGTCTCGGCT
GTCTTCCGCTTCGTCGCGCTCGCCTTTTTCGCTTTCTTGGGCTTCTCCAACTCGATCTTCTCAATCAAATCTTCGGCCAGACCGACCCAGTAATCGCCTT
CAAAGTACGGCAGCGCGCATGCCGAGTTGTCGTCGCGCCAGGAGTCATCGTACATGTTGGTAATCTGCCAGACCACGTTCTCGGCTTGCGCTTTTACCAG
CATGTCCACGTACCATTGCCGCAGACGGTCCGACTTTGGAGTCTTTTGACTCTCCGGGTGGCAGTACAGGATGTAGTCGTCACCCTTGAGCGGTGGACAC
GCCCACAGGTGCGCCGTGTGGAATCCGAGCTGCTTCACAAAGTCCATGTACGCGATCAGCAGCTCGTGGTACACTTTCGTTCGCAAGTGGGGCGGCTCAA
AGTAGTTTACCGAGTCCAAGTACGAGATGTAGACACGGCGCGCGTTGCAGTCGGCTTCTTGCTCGTCAAACTCGTGCACGTACATCCCGAAGAGCAGCAC
CGACACGCCATGGATCTCTTGGAACATGCAGATGCACTTGGACTTAAAGCGATGCTCGTACGTGTACTTGTGCGAATCCTTGTACCGCTGGAACATCTTG
TCGCGCACCATCAGCTGCTTCTCGATGTTCGACACCTGGCGCACAGTCAGACCTTCCGCAGTTTCGATGTCCTTCGCGTCCTGGTTTGTCCACTTCGCTT
CGTCTTCTCGCTCGTCATGCAGAGCTTTAACAATCCGCCGCTCGAGGTAATCCGAAAGCTTTGTGCGCATGAGGTCTTTCGCATTGAACGCGTGGCGACC
AATCTTGTACTTTTGCGGCTCTTTCTTCCGATGGTCGAGCAGACACTCTGGACACAGAAACTCACTCCCGGGCGTCGACGAAATCGAATGCGCCGCAACG
ATGGTGTTGCCATTCTCTTTCACCGATGAAGGTCCGCTGGACGCTGCGGGGTTGCTGCTGCTGCTATTTGCTGGGTTTCCTTTCGAGCCCTCGCTTTTCA
CTTGCTGTGGCTTCTTCTCTGCGTCGATCTTGCCGTTGAAGAGCGCGCAAATCTGGTGAACCCAACGGTTGCACGTGTCACACTGTACCCACGGCTCTTC
ATGGACTTCGTCGTTCTTCTTCCGAGACAGCTCCGTCTTCTTATACACGCGACCTTCGTTGTGCTTGACAGTATCCGTCAGGTTCCCGAAGCAAGGATGG
CAGCAGTGGTACTTGTTGTCCGATGACGTGTAGTAGTAGCAGTTCCGGCGGATACGACTGTTGCACTCGCCGTTGCAGTACAGCACCGCAGGCTCGAACA
CCATTCGCTCGACACCACACAAACGACACGAACTCTCCTTCTCGCGTACGACACGCTCTTCCTCGTTCACTTCCACCTCGAGCTTCCGCAACTCCGCGTT
GAAGTCGGCCAGCATGTCCTTCGCAAGATTGTAAACGTCCTGCTCTTCGCTGTTGTACGTCTTCGCGTTGTTGAATGTCAATCGCACGTCGACGGCAAAC
TGATGCAAGTTCTTGTAGATGCCGAGGTCCAGCTTCTTCTTGATCGTCCCAAGGTCCATGGGGCGTCGGATTATCTTGAAGTAATTCGGAATACCCAGCG
CCACTGGATCAACAGGACTGCTAAACACCCAGCCAAACTTGTGCTCCATCATCCCCTTCAGCAACCCTTCGAGGCGCTTCTTCAACTGCGTCGGAGACAT
GGTCGCGTTGTAGTAAACCACCAGCGACTCGATGTGGGCCTCGAGGTCTTCGTTGCTCAGCTCATTCAGCATTGAAGTGGGTGTATCAGCTGCTGGAGCT
GGAGCTGTCGATGCCGCCCCGGCCACTGCGACGGATACAGGCACGATCGCACCTGCACTTGCACCGACGTTCTCGCCCGAGGGTGCACCAGCACCAACAG
GATTCCCAGTGCGCGCTGGCTCGGCTTTTACTGTACCAACACTGTCCATGCGCCGGTGCTCCTTCATCATCGCGTTCAGCTTCGAGTTGTTCATGGTTAG
TGGATTCACCGCAGACTCATCACCCGGTTTCTTCCCCTGGAATGCAGCACCCGGAGTTTGTTGTCGACCAGCTGGCTGGAGCTCTTTTTTCATCGTCTGC
TGAGCTCCAGAGGCAGATGCGACCGAGCTAGCGGGTTGAGCACTAGATGACGCAGGCTCTTGAAGATCAGGAGGCATTTCCAGCGGCGTCCCAGCAGCAC
CCATGTCCATCCCCATGGGCATTGAAATCTCCTCAGCCAATATATCATCCGGCGACTGCTTCACCATATTTTGTTGCATGACTTGCGGCTGCTGTTGCTG
TGTTGGCATCATAGTCGACGGTTGATTCATTGTCCCTCGTTGGTGCTGCTGGTATTGCGAGTACGTCATCTGTTGTGGTTGTTGAAGCTGCATCTGCATT
GGCATTGCGATGGGCAGCATCGCGTTCGTCGACGGCTGGTTCAGTACCATAGATGTTGCTGTCGCCATCGTACCGGAAGCAGGCGTCGCTCCAGCAGCGG
GGTTTGCCGGCGATCTTGTACTGATGATGTGCTTGACAATACGCCGCTGACTGTTGCACCGCTTGTACTTCACGTCCAGGCTCTTCAGCGTCACCCGCTT
TTCGTTCACCTGCTTCTCAAACTGCCCTTTCACGGTCAGATCCTGCGTCGTGTTCGCTCGTTGCAGCAGTTGCCGACACTCGTTCATGATCGAATTCATC
TGCGTCCGAATTTGCTCCGCAAGACTTTCCAGCTTCTTGCAGTGGCCGTTTAGCTGCTCCAGACTCCACCCTAGCAATTTCTGCTGAATGATCGTCAGCT
GGCGTCGATCCTCCTCCGTCAGACTCGCAACAAACGCGTCGTTCGCGTTCGCACTCGCAGCAGCACCTGGCAGATTGCCGTGCATGTTGCCATTCTGGCC
CATCACCATTCCAGGCTGCAGCTGACCACCGTGGTTCATGTTACC