Description :
From Genome Similarity Track
Location :
Scaffold_558:528- 5495
Transcript NameFunction/comments
Hyaar_Emoy2814321reverse transcriptase
Hyaar_Emoy2814322hypothetical protein

Sequence
4967 bases(100 bases per row)
TCGTGACTCTGAATAGCTTCGAACCGATTATGGCCCGTCTGCTTGCGTTTAAACTCTCGAAGTAATGTTCCACAATTCAAATCAAGTTCATCCACCCAGG
TGGGGTCATCGTACCCCTTCCAACGAACGAGAAATTCTCGTTGCTGTCGCCCATAACGTGTTTTCTTACCAGTGTGGCTCTCCAAATTCTCATCGACCTC
GTATTCACCCTCTTCCAGTTCTCGTACCGAACTGTCTTCCGTCAGTAGGCATTCGTCAAAATCAAACCGATCTGCTTGGGCAACTGTTAACTCGTTGTCT
GGTCAATCAGGGAACTTCCTGACCCGCTTAAGCTTGGATATGTGTACAATCGGAAACAGCCGGTATTCCGTTCCCCGGGTCTCCAACCGTGCGGCATGGT
CTCCTACCAACTCCAGAACACGGAAAGTTCGTGCCAAAGATGAGCCAGTTTCCTAGCATATCCTTCTTTTACTCGGTCGAGATAGAGCCATACTTGGGTT
CCCGCTCGAATCTTGTGGTCGACCACCCCTTCATTCTGCAATTGCACTCGCATCTGACTCGCCTCTCGCAACTTCTTGTTCACCCGTTCTCTCGACTGCT
GGTACTGGCTCTGAATGCGGTACCTCCACCTTCTGAGTTCTGACTCCTGACGTCGGACGTTCACTATCGGTAGTGTGGCAGGGTGGATCTGGCATCCCAA
CCGTGGACCAAATAAAAGGCGTTTCTTTTCATACCCGGTTCTGTGCGGTATTGATCTCAAACGTCAACCGGTCTGCGTACTCGTCCCAGTCCCGTTGCCC
TACTTCCGCGACGTAAAACTTGATAGATCTGGTTAGAGTCTGGACCATCCTTTCCGCCGTACCATTAGCTTTGGGTCGGTGGCCATTGTCGCTTGTTGAC
GTTAACCCACCATACGGTTAAACGCTCGGAAGAAGTCCAACATGAATCCCGGTTCTCGATCGTGACGGATCGCGTCGCTAGCCCTAAAACGATGGAAAAC
ACACTCTTCATATTCTTCAGCGACCGTCTGAGCTGTTCGCGACGCGCTAGCCTTGGCCATTACATATCCGGTGTGGATAAGTCAACCCATATCAGAAGTT
CCGTATTTCCTTATACGACTTAGGCAGGGACGGGATATGGTCCATCGCTATAACTGGAAAGGACAAGTCACTTCGATGTTCCCAGGGCTCTTCCTTTGTA
GGGTAGGTCCCTCTTTTCCAGTCTCACAATCCATGCAAGAACCAACATATCTCTGCACACTCCAAAACAGACCTTTCCAGTGACAGTAACGTCGTATGCG
TTGGTATGTACGCCCGATTCCTTGATGACATCCTTCTAAACTAGTATGGTAGTGGTTGAGGAAGTCGGTCTGGAGGCTTTCCGGTATCACCAGTCTGACC
GTTATGTCACGGTCTTCTCCCTCGACCCTAGAGTTTGGACAATATACCAGCAACCCTTCCTCGCTTACATCGTAATCTCCGTACATTTTGCCGCACTTTT
TAGCGAATTCCACCGACAGGTCATTCCAGTCTCTTTTCAAATATGCCTTCAAATCTCGTACCCAGCTCTCCTCTTCTTGCGCCTTTCGAATTCGGTCCAC
GCGGATTCGCTGTACTACCTCCTCTTGCATGATCTCTCAGGATATCCTATTGGGAGACCGCGACCGAATTACCGCAAATATTTTGGTCGAGATGTTCTGG
TATTTTGGGATTTGTAGCTCCGGTAGACAATTGATCGCTTCCAAGCCTGGTCTTATTTCACTCGGCACCGACTTGATCCCCTTTTTGTTGCAAGGCAGTG
CTAGCCAACTGATCTGCGCTCTGATTTTAATCTCATTTTACATGTAGGATCCCATGAAAGGGCCACGTTTCAAGTTCATTTAAAGCCCGGGCTCGTAGAG
GGGACAGACCCGAGGCATTACACTTAATCTCCCCTCGTATCTTCCGCACCACTATGTTGGAGTCTCCACAGATAATCAACCGTCGCTGCTCCAAAGGTTT
TAACAAGCTAAATCTCAGCAACATACTCTCATATTCTGCCTCGTTTACCGTAGATGTATCGAGATATTTTGAGGCGGCTTCAACTATGGTCCAAGTCGGG
AGTCTCCATACGATAGCGCTACAAGCCCCACCTCCTTGCTTGACATGGGCTGACCCATCGAAAGTCATTGCGTATATTTCTTCGTCTGGTTCCACGGTAG
GGGTGGGTAGGTCGATCGTCTGCCCCGCCTGCTTCTTAGGGGCAATGGCCGAAAGTATTGAGTCTACACTCTTTCGAGGGGTGACACTGGCTGCCAACGC
CCCCCAGCACCTGGTCCTCACCTTTTTTACACTTCACGATCTCCAAAGTTCACTAAGACAAGAGAGCGGCCCAGTTTCCTCAGCGTCCCTGCAAGCCGGT
AAACTTTACCAACCATGCCAAGTCGAGTGTCTTGTCAAGACATTGAGGGGCCAAGTGACTAGCATAGTGAAACAGGTCTCCAGTATACGCAATAAGGCCA
ACACCTCTTTCTCCATTGTGCTGTAATTTAATTCGTTATCCTTGAGGGGTCTGCTTGTAAAGGTTACCGGCATGAGCAGTCCTTCATAATCCTGTACCAG
TGACGCCGAAATGTCCCATTCACTCGCACAGACAATATCACGGCTTCTCTGGTTGGGTCGAAGTGTCTCAGAATTGGCTCCGTGACATTTTTATTCTTGA
GCATGGCAAAGGCTACATGAACGTGGGCCCACCTTTCTTCATTGCCATCTTGGGAAGTGGCATTATTATCTCCCTTCGTCTGGTTTCGTCGGGCATGAAA
GTCTACTTCTCTCAGTTCATAGAGGATAGATGCATACACGGCGTAGTCCTCAATAAACCTGCTATAGTAATTCACGTTTCCCAGAAAAGATTACATGGCC
TTCAGTTTCATTGGTAAGGGTAGGTCGATCAGAGATTGAAGATCTTTCGAGTGAGCCTCTATTCCTTCACTAGATACTCGATGTCCAAGATAGTCAAACT
TCCGACATCCCCACGAACTCTTGACTGCGCTGATCGACAAATTCCAGTAGTCACACACATCCAACAGCCGTTCCACCTTTGTGCACAGCGCATCCCATGA
TTCGGCGGGAATCAGAATGTCATCTATATATGACCGCCGAATCAGGATCAAGGAATTCGACTGCTCATCTGGCTCTCCCACCTTAAACATATCCTCCGAC
CCATCTTTCTCTGCTCCTGGAGGAATTCGTAAAACTCATTTAAAGCGTTAATTAAGAGTCGCTGATATATTTGGGGCGCGTTCTTGAGTCCAAACGGCAT
CCGCGTCCATTCAAACAAATTCAGTGGGGTAATGAACGCCGAAATTCGTTTCGCCCTTTCAGTCATACCGACTACCCAAAAACCAATCGCATTATCCAAC
GAGCAATACCATAATGCCTTGTCCAATTCTTCCAGTAATTCATTAATCAGAGGCATGGGGTGTACCATTAGTTGAGCCAGGTCGTTCACCAACCTGTAGT
GGATGCATAGTCTGATGTCCACCCCATTTTTCTTCACAATAATAACGATTGGGCTGGCCCAGAAAGACGTCGAAGGCTGTATAATCTTTGCCGATAACAG
CCCCTTGATCAGATCGGCCAACTTCTTCTTAAATTGGGAAGCCACTTTGCGTACGCGTTGCGCTATCGGCTTCAATTCCTAGATCAGTGTCACGTATATC
CCCTCGAGCTACTGGCGGTAACGCCTTCCCTTTCCCCATCAACATATGTCGTCTCTTTCAAATGATTTGTCGCAGCCTGTCCACCTCTTCTGGAGTGTTC
CCATCCGGATCAGGGATCTGTATATCTTTTAATACAATAGATTCGGAAGAAGGGTCCACTTCTGGTATGATCGCCCACCCTCGGTTTATGTCTTCTTCCC
ACAGGTCTCCGCTTTCGAATGTACACACTTGTTCATCGTCTCGTGGAAATTCGTTGGCCTCAGCTTCCTCTCTTTCTACTGCGATTGCTCCCGGTGGATC
GTCTTTGGAGCCACTTCGTACTTGAGGGTTCTCTTCTTCGCGTGAGTGTTATTTTCTCTGGTGACGGCTGTTGTGACACGTTCATCATTGAGACTGGGGT
ATTCGACCGCTGCAAAATACGCGACGGGATCTTGTACTGCGGGGTCTCCACCATTGGTGTCTCGTCTTCCTCCTCGAGGTCAACTTGGGGGTCGACCTGG
TCGGTGGTGGCTTCGTACGCCAGGATCAGCCACTCAGCGTACCTTCGAGAGCCTAACGAGACGTAACCTTGTGCTCTTGGTACTTGATCCTTCGTCAGTC
ACATATCTATCTTGGTATCATCATGTAATATCAACGTGTGGAGGCTGACGTTGGTCACTATCAGCAACTGTCAGCGTCCTATCCCCCGGGTCGTAGTTGT
AACCCATCGCTCTCCTCTGGTGACCCATATCCTCCATAGATCTTATATTGACCTTTTAAGGGGCACCTCCACACATCCACCGGCAATTATACGGGCATAT
TGTCCCATCTTCACGTATGCGTCTCGATTATCGTAAACGGTCCTTCGTCCGGAGAGTTGTATCCAGAATTCGTTAGGGAAGACAGAGTGTTCCATCCGCC
AGATCCAGCCGGATCCTAGCCGGGACCATGAAATCCATTCCTAAAATTGCATCCTGAATCACCATAGGGCCTTCCCACACCTTGAACACATACACTAAAT
TTCCATCTAGGGTAACCTTGATGCGAGTGCGCCCTTCCGTAGAGTACACCGATTCGCCAATGCACTCTTGTCGTTCGCATTCGTTAATTTGGCAGCCTAC
CTTACGAGAAAAGGCAACATCCAAAATGGATATCTTGGCGCCAGTATCAACAAATTTGCACGATCGTTGTTAATCTTCCCAGAGGCTTTGGCTTGTTTAA
ACCACTTGGTTTGGGAGTGGTATTTCCAGTATCCTCGGGATTCCCTAGGCAATAGGTCTAACTCCAT