Description :
From Genome Similarity Track
Location :
Scaffold_1174:528- 2543
Sequence
2015 bases(100 bases per row)
CTGACACCATCAGCCGAGTTCAGCGGTCCATCAGCGCATTCTTGGCCACCGAGCTCGGCGGACGGTCATCCCGCCGAGTAGAACTTGGCTCCTGGTACGT
TGTTCCACTGCGGCCTTAGAGTGTGACACAAAACTTGATGTTCCCTACACCACACTCCGGCTGAGGTGGCACCGACTGTCCCACCCGTCGCTCAGATCCC
GGAGCCCGAGCTCCGTCAAGCCATTTCAAGGCCATTGAGCAGAGTGGGTGGCGCCCGCCTGCGCAGAGCAATTCCCGTTCAGGGTGGCAGTCGCCCCGGC
CGGGATGGCAATCACCTCGGCCCGGATGGCAATCGCCCAGACGGGAGAACCCTGACCGGAACGAGTTTTGCGAGAAGTGCCTCAAGTTTGGTCACAAGGA
GCAGAACTGCTGGGCGGAGATCGTTTGCGACCGGTGCAACCGGAAGGGCCATCCGGGATACGCGTGTTGAGTGAAGCCGTGCTCACGCTGTGGCAAGATT
CATGAAGGAACCTGTGGAGATTACGACGCCTTGGAAGCCGTGAAGAAACTCGCACGGAAGGGGATGTTGCAAGACGTGCCTCCACCCCTGCGCAAGCAAC
TGCTGGGTGAAGAGGCCATCCGGGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGTACTGAGCCCGAGTGTGATATGACAGGCTGATGTGGAGACCCG
GGCGGACTACCCCGGATGGGGAACAGAAGTTGCGCTCTATACTCAAGTATCACCGCAAGATCTTCCTTGGGGATGGCAATGCTGCGCCGGCCCCGGCCAG
GGGTGTGGTATGTGACCTGGATGTGGGTGACGCCAAACCCGTTGCTCAACGACCAAGGTCCATTGCCCCTCACTTGATGATGAAGGTGTACGAGCTCCTG
AATAAGCTGCTGGAA