Description :
From Genome Similarity Track
Location :
Scaffold_2038:528- 2111
Sequence
1583 bases(100 bases per row)
TGCCGACCCACTTTCGCGCTCTGCTATGGAGTAGTCCCCATTACCTTGCAGCGCTACAAGATGCGCATCCGAGACGGTAACATGTCGATCAAGACGCATG
GTAACCGGCTCAACACGCATGCAGCTCAAGTGAACGTTGTTTGGCTGGTGAAATGGTTCCAGACGTTTGCCGAGGAGGTCGGCGAGGTTGTGCCGGTTCG
AGTGCGGATGCAGAAGAAGAAAGACGGAACTACGCAGAAATACTACAGCAGCGAGATGTACACGTTACTACCAGCGCACTTCACCTGGGATACCATCTAC
GACGAAATGCACAAGTTTGTTGAGGCGGGCTTGCGCGTCCGTGAACCGCTCGGTCGACAATGAGGAAGCTTTTGACGCTTCACTGTCCAACCATTCGAAT
TCGGTCGCCACGTAGTAACGTGTGCGACGTCTGCTCCATTTACCACGCTGGAATGCGCGGCGGCGTAACCAGTGACAAGACGGAGGCGCTGGGGCGGCAC
ACAGAATCTGCGCGTCGAATGCGGTAAGTTTTGTATACGGACATAAGAAACATTTTGATTTACTCGGCAGATTTACCTGGATGTTAGTAACATTTTGTTT
GATGGCTGACAGGCGGGAGTACAAGACGGACAAGACTTCTACCGATGTCAACCACGCTGTCATCGTGATGGATTTTCCCCAGAACTTGACACTTCCGAGC
GTGTCCAACACCCTCTCACAGTGGTACTTTTGTTCGCTGGTCTCTGTGAGCGGCTTCGGTATCTTTTACGAGAACGAAGGAATCCAAACCAACTATCTGT
ACAACGAGACTTCGAACGGTAAAGGGAGCGACCAGATTAACTCCATGCTGGCTCATTTCATCAGCACCAAGATCATACCGGCGGGGAAGACTCGGCTGAC
CGTGTACGCCGACAACTGCTCAGGGCAGAACAAAAACAGCTACGTGATCAAGTTTCTATTGGCGCAAGTACACATGGGAGCTCTACAGTACGTGGACTAC
AAGTTCTTCGTCAAAGGGCACACGAAGAACTCCTGTGACCGTGGTTTCGGCCACATCCGCAAGCACGTGGCCAAAGTGGATTGTTGGACGATGGACCATC
TCGTAGAGGGTGTTAGTTCGGCGTCCAAGAGCTCAATCACGGTGCATCTGCCTCGCGGAAGCTCAGCGTTCAAGTCCTACAAACCTATTCTCACCTAATT
GTACAAACGACTTGACGGCATCCAGAAGTTCCAGATTTTCACGATGGACGCATCGCAGCCGGGCGTCGTTGTCTGCAAGAAAGGCCCCGAGAGCGAACCT
GTAGAGATTAGTTTGAGCCGTCAAATTGACGGGATCTTCACCACGAAGGGGAAGGTGCAGCGGATGATGACGGACCATATCGAGACGCTGTCCCCTCCTG
TCCGCAACACCGAGAAAATTGCGCAGATGTACCACAACATCAGGCCCTACGTTCCTGCTGAATTTCAGAGCGATCCCCTCTACGCCAAGCCTAGCGAGCA
GGAAGGAGAAGATGCCAAGTCACGGAAACAAGCACGACGTGAGCATCGCGCGGCAATGGCCGTAGCGGCTAAGGCTAACCAAG