Description :
From Genome Similarity Track
Location :
Scaffold_33:52796- 57942
Sequence
5146 bases(100 bases per row)
CATCCTCCCCCACCAAACAGTCGATACCCCGAATCGACATCCTTCACCTTTCTCATTGAAATAGATCGGGGAGAACCGATAACCTCACGGTTGTGTTCAC
GACACCTTGCACATAAATGGCGAAGTCTTCGCATACCTCCGAGTCTCTGGAGACATCATACGAGAGGAGAACATCGTCGATGATGACAGTGACACTGTCG
TGGAAGAAGGTGAAACACCCTAACCTGCCACGTCAGCGTCATGCGAATCTTCTCGCATAGCGCCAAACCCATTTCCGGAACGAAGCACGGCTCAAACGCT
AACAGCGTTGCGTGTCTCAACTACTCTTGATGAATCTATCATCACCAACAAGCTCGATAAGCAACAGCAACGCTATATCGAGGAGAATAAGAGAGCTAGA
ACGTCTGTCTCAGACATTAGCTATCGCCGAAGCGCATTCAGATTATTGCTTCAAGCCTTTGGACGTTGATGAGTTGTTGCAAAAGCTCGCAAGGCAACCC
TTGACTACTTGGCCCACAGAGCACAAGGCTACGACGTCTGACGACATTGCCGAACGAGATGCTCTCAGAGAGAGATACTTGACGCCCGAAGCGACGAAGA
TCTCCGAGTATGAACTCAAGTTAACGGAACAAGCACGTGGTGCCTCTGTACCGACGCAGAGAATGGTCCCGGTCGTTCTGTACCCAGGCGAGAGTGAGGC
CGAGGATGACAGCACGCTCACTTGTTGGGCACGTCGGTTGCCCAGCATGAGTGCCTTTCGATCTAGTTCCTCCAAGGCCGACGTTCGGCTAGAGCGCAAG
CTGAGCTATCAGTTTGCTAAGCTGAAGGCAAAACGCCAGCTACGTTCTCAGTATCGCAACCAGTACGCAACACCAGTTGCTGGTCCAACCACCACTGTTT
CGACTGTGCAGACAGTCGCGGGTCACTCGGTATTGGTGAGCGAGCCGTACACTTCCACAACTATTGGTGGGAAGCGCGTTGGGGTGCAAGCTGACCGGCA
GCGCGACGCTCAAAAACGTCAACGGCGTACGGGGAATCTTGCCGAAGGGGTACCTCAAACTCCCATGAGTTCTTAGACTCAGGGTATCCACGCCACTTCA
CCAGATAACGGCATTGACCTTTGTGATGACGCCGATTCAGAAGCTTCTTCACATGGAACTGCAAGTTTCCTTGCTCGTCGAGCGACGCAGGAGGGGGTCG
TTGTGTCGGTACAGGCTCATGAAGACTTGGTGTCAGAGGTGAAGCGACTTCGCGAGTCTTTCGCTCACGTGCAGATTGCACTGGATCAGTCTGTGAATGA
GAGGAAACAACTCCGCGAGATCCTCGACCAAGTGCAACGCGCTCGTGAACAGTCATCGACGGAGTTGGCTCAGTTACGTGAGCAGATGAACCGTCTCGGC
TCGATCGACTCGGTGGAGCCGAGACTGCGGAAGGTGGAGCACAACCTTCCACGGCTGGATGGCCAGGTGGGAAGAAGAATCATTAACGGGGACGACGTCC
CCCCTTCAGGCGCAAGCGCCTTCTGGTCCACGAGAGAAGGATCTTCATATGGCTTAAGCAATTCAACGTATAACACTGGGTGTGTGCGCAATTTGCGCGG
GAGGTTGAGTGTATAGGCAAGGTCTTTTTTCGCTATGACCGTAAACGGCCCAATGGAGCGCGGACGCAATTTCGTCTTGAAGACGGCAGCCACTACGTTT
ATAGGTAGGTTTTTTAGAATTTAGGAAGACTTGGTCTCCAACTTCGTAAGGATAAATAATCCTCTGCCCTTAGCATCGGCTTGTTCCTGTTGTTTGTCTT
GGCTATCAGCCATTGCACCACGCACATGGCGTAATACACTAAAGCGCGTCGTGAAAAACTCGCTCACTTGTTTCTGCATAGTGGTAGCGCTGATTTCAGC
AAGCTTGTCAGCAGACTCTCCCCCACCAAGCCCAGCACCACGAGTGGTAACGTGAGCGGAACGCGGGGGTGCGTGAGGCTATTCACATAGAATGGAGTAA
AGCCGGTCGAGGCATGAACAGCGTTGTTCAACACAAATTCAACAACAGGGAGCATGGAGATCCAACGCTTAGGCGTATCAGCGCAAACACTGCGTAAAAT
GTCATTAATGACGCGATTAACACGCTCAGTTTGACCATCGGTCTGCGGATGATCCGCTGTGAACATGTCCAAACGGGTGCCGATCACCTTGAAGATGGAC
TTCCAAAACTTCCCAGTGAAGCGGAGATCTCTATCAGAGACAATTGCCACTGGCAAACCATGTTGTCGAAACACACGGTCGATAAACAGCTTCGCTGTAC
CTTCGGCATCAATAGAGTCCGGTACTGCCGCGAGATGAACCATCTTGCTCAATCGCTCAACAAAGATCACAATGCCAGTGTTGCCTTCCGAATCTTTCGG
TAGGCCAAACACAAAGTCCATACTCATGGACTCTCAACACCCAGTGGGTAAAGGCAGACTAGCCAGCGGCGCCGCCGCATGTGCTGAGGTTTTCACCCGT
TGATACGTTTCACAAGTACGCACATAGGTGCTCACCCATTTGTATAGTTTGGGCCACCAATAAGCCTGGCTCACTGAGCTACAGGTCTTCTCACGACCGA
GATGACTACTTAAAGCGGTATCATGTAACTCATAGAGGATTCGAAACTTCAACTCCTCACCATGAGGGACAGCGATACGAGGGTTATCCTCAATATATAT
GCGATAGCACAACAGGCCATTATTGATAGAATATCGATGTAGCCTCTCATGTAAACGTACCGACAATTCTATGTCCGAGTCTTTAAACTCCTCGCTCCCA
AGAGCAAGTAGCAAAGCTACACATTGTTCATCCTTGGCATAAGCCGCACGGATTAAGTCAGTGACTGACGATGACAGCGTAGTGACGTGAGCAAGCTCAT
AGTCAGGTCGGCGCGATAGCGCATCAGCCAAAACATTTTGATTACCTGGATTATACTTCACTCCGAAGTTATATTCGGCAAAGAATGAAAGCCAACGAGC
AATTATCTGAGAGTGATGCGGCGACTGTGTCGCAGTACGCAATGATGCATGATCTGTATAAATCAAAAATGGCTTTGAGCCAAGTAGATGTACTCTGAAT
TTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTTCAACAGCTTTGAGCTATCAAGATTCGAATGCAATGACGCGTT
CGCGTCCATCGACATCTGTTTGTAAAATTGCACTGCCTATGGCAAAGTCAGATGCGTCACAGACGACACTGAAAGGCCGATCGAATCTAGCAAAGCCAGT
ATTGGCGCATGAAGGAGACTTTCCTTAACTGCTTGAAAAGCATCATGTTCGGTGTTACGCCAACAACAATCCACATCCTTCTTAAGGAGACTGGATAATG
GCCGAGTCATGTCTGCGTAATTCGCAGTATACTTATGCAAGTAATTGGCAAGGCCAAGCCACTTACGTAAATCGTTTTGGTTCTTTGGAACCGTCCAATC
GACTATGGCCCTTACCTTAGCGGGGTCCGCTCGAAGGCCTCGCTTCCCAATGAAGCACCCCAGAAAGGGAATCTCTTCTGCACCAAAGATGCACTTAGAT
GCATTTGCATACAATTTATTAGTGCGCATGCACTCGAGCACCGCTCATAAATGATCAATGCGATTATCCACATCAGATCGACTGGTCGTTGCACGACTAT
GGACAAAGATGTCATCAAAGTGCGTTTGTGCATAGCCTCAATGAGGTCTGAATAGTTGCGTCACCAGACGATTAAAGTAGCCGGGGCATTTGACAGCCCT
TGTGGCATAACGAGCTACTCCCAGATCATACCGCTCGGGGTACTAACCGCTGTTAGCGGAATATCGCTTGCTCGTATGAGCAGCTGGTAATAACCATCGA
CTAAGTCGAGCGCACTGTACAATGTACATCCCACCATACTGTTCTGAAGAACATCCTTTCTGGGGATTGGTGTCTGAGCCGGGATAGTGGTAGCATTAAG
CTTATTATAAGCGTGCACAATACGCCACTTACCATTAGGCTTTTTGACACAAAATGTAGGTGTGGAATGGGGAGACTTACTCTCCCGCACCATTCTCGCA
GCGTGCTTAGCACGAAAGAAATCGTCAATGACGTCACACTGTTCGTTAGGTAAAGGCCACTGCTGTGTTACGCAGTATTTAGTTCCTGGAACTAGGTCAA
TTTCATGATGTACACCTCTATCGGGAGGTAAGACAGATGGTGGATTGTGACACACCACATCTTAGAATTCCGTTACCAAAGAATAGAATGGATCTAAAGT
ACAAAGATCCACTCCGGGCACTGAGTGCCGCCTTGGTGTCCTCTAGGACAGACTCATGTATTAATGAGGACAAGTTCAACTCAACATCGGGTCTAATGAC
CACTAATTCGGATAAATCTCCTGCCTTCAAGGCCTGGCTAAACTCGCCATCAGACATTTCGTCTAGCTCATAAAGAGCATCCAACGATGGAAGGGTTTCC
AGGCTGACATTGCCCTCCACCTGGCCAGTCACTCCGTTGACAAGTGTGTATAGTGTATCAATATTGTCACTATGTGACTGCACGGACGACTGGCGCTTAA
CAGTTGTCACCTGGCGTCCCGGTCGTCTTTTCGATGAGACCTTACACCCCTCTGGGGTCGGGAAAATAGTGTCCCCGTGGTTACTACTACTAGTAGTACG
CTCTATACGAGATCTGATGTCTTGATCTACATCCGGTGAAGTTTTACGTAACTCGAACACTTCACCCAGTGGATTTAAAAGTGCCATTCCACTTACATTA
TACGGGCCTAGCCCTGAACTTAATGGCGTTTCGCCAACAATGTCATTACCGACATTAAGTGTGGTGCCTTCACGGCCGACCGCACTAGATGCGTTTTCAC
GTGCCACCACACACACATCAAAGGAATCACATCCGTGATAACTCGGCCCTCGACCAACCATGCTTTCAGCATGCAGTGACTCGTTATCACAACGAGTAAC
ACTCAACGGAGTACGTGCCGTATCACTAGTATTCAACGAGCTACGCTCGGAATTCATATTTTCAACATTGGAGTTAGTTAACTCAGACATTTCAATGTCC
AGCACATTGAAATCTTCTGTCAAAGGCTCGCGCCAATAGTGCTTTC