Description :
From Genome Similarity Track
Location :
Scaffold_28:527922- 528989
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12296hypothetical protein

Sequence
1067 bases(100 bases per row)
TGCACTCGTCATACATGTCTGTGTCACCTCCGCAACAAGCATCGTCTCCACGAGATACGTTATCACAGGTGTCGTCATCGTCTCCAGCGTAGCCGTAGCA
TTGACAGCAAGTCTGCATCGCGCCGTGGGTATCAGCATCGCCCGAGTCCACATTAAAGATGTCAATGCTCACACCAGAATCTGCGTCTTCGATAGTGTAG
ACGTAGAAATGGTCCTCTAAAATCCAGCGATCGTCGTTCGGGCTCGTGTACGTTGACTGCCATGAAAATTTGTTTTTCAAAGCGGTGACAAGCTCGTCCG
AGTCGGAGCACGCAGCAGTGCCGTCGCCCGAATCCGAGCAAATGTAGTCGGCCCCACCATAGTCGTGGTTACCCAAAACATTCACCCACGGGATCGTTTT
GATGTTTTCACCGTCGTATTTTTCCTCGAATGTCGTCGTGAAACGAGTGTCACGACCGTTATCGCTGTTGATACCAGTCCAATAAAAATTATCGCCGTGG
CTGATGATAATCTTCGGGGCAACATCAGCACTACCGGCCTGCTGATTCATCAGATTGGCCACGATATCCTCGGCATTAATGTCGTAGTCGTTGTAGGTAG
AAGAGCGAGTACAACATGAATCCTGCGAGACAGTAGTGCCCCAGTCTCCGATAGCAAAGGCAGACAACGAGTAGGTGACGCTGGTGGGGTCCGACGTGAT
GCTGGAGGAGCCACTTTTATTGCTCTTTGTCGTCTTCTTGGTTGATGATGCAGTGCCGTCGGAGGTGTACGCTCTGCTACTCGAATCCGAAGAGCTGGCG
TCGACACCATCAGTGGAGCTGGTCGAACTAGATGACCCGCTGGTCATCACCACGCCGACAATCACGCCAACGACAGCGCACACGACCACCACCCCGATGA
TAATCCACGTCTTCCTCGGTAGCCCCATTTGTCCTGTTATCCTTGACCGCAGTGAATTCGCTAGTGAGCTAATTTGTCTTGATTGGGTGTGCACAGGCAG
CGGTAGTTCATTCGTGTACTAATAACTAGAGATCCGGCAGGAACTCATTGATTAGCGGGTTTCAGTG