Description :
From Genome Similarity Track
Location :
Scaffold_807:5279- 8519
Sequence
3240 bases(100 bases per row)
TGCAAATTTTGTGTCCAGGGCTGCCCAGCATCCTGTGGAGTCGTTTTTCTGTAATACTGCATTAAGATCCGCGTGACCATCCAGCACCATAAAGAGTATG
TCTAGATGCTCCATAAGAGTAGTTGGCTTGGTTACTGGTGGGGGTAGCATTAACGCCAGTTTGTCGCTGTAAATAAAAACTGTGAGAATTACCCTTGCCA
GTTTCTGTCGTTGCGATTCTCTACAGAGTTTGAGATGCTCGGATCTAGTATACATTCGGGCCTGCATTTGGCGCCAGAAAGTCTATTGGTATAGATTCAC
CGGAACATTGCTGTTGATAATTTTCATCAAAATGCGGTGCTCCACTCCTGCAGCCACTTCTTGGTTTCCGTAGATCCACcttgtgttgctgccagtCTGT
CCATACTGTGAACTAGACAGTCCCTTCTCGTTTCCTCCGTCCACAGATCGAAGACCGCATCAGTCATCTTGCTGAGGACGTAGGCTGGCGATTGGTATCG
TTGTAGAAGTTGTAGCTTCTCCTTAGGAGCAACCGAGACCGTGTCCTTCCATTGTGACGCTGATCTCGGTAAGGAGGGAGATTCTGACTGCGTTAACTGT
TCTCAAGTAGTCCCTAGATAGCTCCATTCCACTTGTAGTGCTTGTTGGCGGAGACGATTCGTGCCAAGCATTTCATTGATATAGCGCTTCGGAATTGGTC
TCTTCCATTGGTTCCGGTGGTGTGGCTTgagttgatgttgctgcctAATCGAAATCAGATTCGGATGCCACACTCGTTTGAGTTGTAGTGTATGAAGATG
ATGATCCGCTTGGCCGAACCTCACCTTGTCATCTACCTAATGTTTCCACTGTAATCTCGTAGGTTGCTGCCCATTCGGTTACTTTGGCTTCATCCATCAA
ATCAAATTCTCTTAGCTCTCTTCGTTTTCCTGGGGAGAGCCCTTGTAGGCTTGCTGTGGCGAACGTTTCAAGCTCGGCTGTTCGGGATCCTCCATACGCC
TGCATCTGTTCGCGTTCTTCCACTTCCTGTCTGGAGCCGTAGTTTTGGTTGTATTCAGTTTGTTGGAATGGAGTGGCTGTGGCGGATACGTTTCTATTAA
CTCGATCCAATACTCAtgccttcttctcttggCTATCTCCAACATGTTGCATGGCTACGCCTTCCTGGCTCTCTCCCAGCGTAATGTTGGTTCTGCTAAA
CTGCAGCCAGCTGTAGGGGTTTCCATCATACAGCATTACATTCGGGTTTCTTTTTTCTGCATCGCTGTTGCTCCCTCTCGTGGCAGTGCTTGTATCCACT
GTCTTGGTTGGTCTTGGCCAATGATTATTTCTTTTGCTGATGGGAACCTTTCCCCTCTGGTGTGGACTTCCGCTGTTCCATAGATCTGACAGCGGGCTTA
TGTTAAGCCTGACTTTGCTACTACTACAAAGATGGGTCGTTGTAGTATTTTTGCAAACATGCGTAGTGTGGCTGCTGTACCCCAACAGCGTTTAGTGACA
AAGGCTGAAAGTTTCGAGCTGGTGCGTCCGATTTCGTTGGAGTAACTGTTAGTGGCTTCTATTGTTTGTTGGGGCGTCAATTTCGGGTTTGTCTTCCCGT
CTTCCAGAGTATCCGGTTCCGACTCAAGTACTGTCAGCAGGTGCTCCCAGTGATTATGTAGAAATTCCTTCTCAAAGAAGTGTTGAGTGGCTGCCAGCAT
TCCTGTTTAATCTTGCCTGTGAGATTTTCCCAAGGTTTGATGTTGTCTCTGTTATCAAAGTCTCGTTGAAGCAGAGCTATGGCTATCGCTTAATACTGAC
AATTGCCGGTAGCCGGAATCGGTACTTGTTTCAGCCCGCAATCCTTAAGCGCCTGGTGGCCCGGGGACCTTGTTGTTCGTGTACTCCTTGACTTGAATTT
GCAGGCATTGTTTAAGCGCTGTTGGCCACGACTCCATCTTTTTCTCGGTGATTGTTTTTCGATGTATTATGTCTGTTTTCGCATAGCTGCTGATCTCCGG
CGTAGTGCATTCGGAGCCTCCTCGGAGATGGTGCTACCGCTCAATGCCTGGGTATCCTTAACCTCTTCTGAGATTGAGCTCCCAGTCTTCGGCCTTGACT
CGGGTGCTGGTTCCATTATggtttcttctttttgttCTGTTTGCTGTCGTTCTTCTGATAGGGAACTTTGCGAGTGTGGTAGAATGCTTCTAGGTGGAGT
AGGCGTTTTCAACCGCGTTGCACGTGCACCGGTGCTATTTCGGTGGCGATTGAGCGGTCCGCCTTCATGCCATACCTCTACCTGTGGTTGTCGTGGCAGT
GCTGGGGTTGTTGCTTGAGTACGTTGCCGTTTGGCTGGTGGTCTTCTGGCCTGCTACCTACAGTTGTCCTTGAACATTGTGCATTGACTTCGTCAATCCA
GTATGTCTCTATTGAAGTAAGCTAGTGATCATTGTGGGTTAATGAGGGAGCGCCTCGATGTCAGGCGGCCGTACTTTCAGACAGTGGTGTGTGCGCCAGC
AGTCGTTCGCTACACTACACACTGTTCTCATATTTCTGGTTCCTCCACATGCAAAACAAGTTGTCGCTGGGCTCTTGCTCATGTGATACACAAGCCGTTT
TGGGCTATCCCAGTCAATGTAACTTTTCCCTTCTAAAAGTCGTGGACATTGCGTGCTTCGGAAACAAAACAAGCCATACATCCGTTTGGTGGACGTATTT
TCTGGAGGTTGGTTTGTGTACACTCCTGGAAAGTTTGCTTGAATGAATACTTAATGGTCCCTTCATCTAAAACTAGTGATAGGTTCAATAGCCGAGCACG
ATAGCGTTCCCGGGTCTGTTCATTCCTGATTCCATCGATCCCGTTTTGTCTGGACCACACTAATGTTACTCAGCTCGCCAAGGCTTCCTGGGGTCTGGCC
ACTGGTTGGTGCGTATTCTTGAGTGAAAATCGTCTGTTTCTGAAAAGAAGTACCTTAaacacttcaactcgtccTTCACTTCCATatgcagcaagaagta
cCGCATGGACTCCACTGTGTAGTTATCTCTCTCGTGTAAAAGATCAAGGGGATCGCGTGCCGTCCCTTGTCGTAGCAGATCTACTTCGCCTCTTGTAGCA
TTGCTACTACTTTTGAGCTGTCGTGTCCACCGTTCCAAGTTCCAATAGAAATGCATTGGTTAAACGGGCGCGTGTTTGAATTGGGCGTATACCTTAAACT
CAGGGGTCAATTGCAGAATGAGATCACCCTCCACCTGCGC