Description :
From Genome Similarity Track
Location :
Scaffold_44:5279- 6362
Sequence
1083 bases(100 bases per row)
CCCACACCAGCACGGAAATTGCTCACTCAATCCAAACGTAATGTGTCTCTAGGGATGTCGAGTAGTGGCAGCCGTCAGATCGACGCTATAGCAGCTCTGG
AGCCCAAGCCTCTCTTCATTCGGATCTGTGCGCACGTACTGGCTCCAGACGTCTTGAAGAGGATATATTCACGCGAAAAATTCAACAAGTTACCACTTCC
GATGACGAACGAGATATCACGTTTGTTGCCAGTAACTTCGATGGTCAGATATGTGAAGATACATGAAAGAATCAGCGAGTCCTGCAAGCCTTTAGGACCA
CCACTGAGACTGCCGGCTTTCTTCTCCTTCATGCCGACACGCAAGAAAGAATCAAAGAGTTAAACCTCGCAGAATAAGCTCTCGTGTTGCTGCAATCCCC
ACTGATCTTCTCTTAGACGGAGTTTCTTACCGCGATTCCCACAACCAAAAATAGCAATTTATACTTCAATAACCACCATTAGTGCTATCGTGGAAGCTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN