Description :
From Genome Similarity Track
Location :
Scaffold_801:5279- 6281
Transcript NameFunction/comments
g11986.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCGCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAGTCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGTTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGA
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGTGCGTGATGTTCGTTGTCGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGACGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTG
CTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGCGCTACCGAACCGAGTACGCTCGGTACGCGTGGGTGCCTTATGATATTC
ACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGACGAACTCAGCCATCGGCAAGCGGTCGCTCCCTTGATGGAACGAGTGCGCGT
AGCTCTTCAGGGTGTCAACCAACACGCGGTTGACATGCTCGGTTTGTCCGTTAATCTGTGGGTGATCCGCAGTTGACTTGGCAACTGCGTCCCAAGAAGT
GTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCTCGATCCGACATAATGTCGAATGGCATACCATGGTGTCTAAACACCAGGTCAACAAACA
GACATGCCGTCTGTTTGGCTGTCATCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTT
GT