Description :
From Genome Similarity Track
Location :
contig_6:527722- 529093
Transcript NameFunction/comments
g2318.t1hypothetical protein

Sequence
1371 bases(100 bases per row)
GAATTGCGAAATGACTCTCTGTCACGGCCAGCGAACCGGCTCGTGGTGGCCATGCTGAATGATTTCACCAAGAAGGAGGTTTTCTTGCCTGGCTTTTAGT
GAATGCCCGTTTTATTGTAGTACACATCTATTATTAAAATAATAATATATGCGTGTTAATAGCGTACATCTGACGGTTAAATCCGATGGCAAATACTAGT
ATCTTTTTTTAAAATTTAAATCTGTACCTTGCTGGTTTCTTTTTGCTGACAGAGATGTTTGCAGCGGCTACATCGTTAGTTCTACATGTACTGGACTTTC
AAGTAAGGTTACTTGGATATTTTAAATAATAGCTCACGCCAGCTGAAAGCCCAAATACAGATCAAAGTAGTCCTTGAGTTTCGTAATTAAGTGCATCATC
ACCTTTCAGTGTGGCCCTCGGCTTTCCTCCTCCTCAGTGTCACCTTCGCGTACACTTCGGTCCTCTTTGATTCAGCCCTAATTTGACCGCAAACCACAAT
TTCGTGCACTGTAGTTGACAAGCAATTTACTGAACGTTTCACGGTTTGGTTTATTCAGGGTGTTATTATAATTAGTAAGCTTAGAATACCCCTCACTGTC
ACTGTTGACCATCCGTTCCTGTATTCCCCCATCTGACGCAGCTGAACCCACTATAAGAATATCGCCTTTACATGCAAGTCATTTGAGGCTCAAACGACTT
GCATTTTACGGCTCAAATGAGCCGTTAAATTCTTGAGCTTCCTCAACCTTCGCCAGTGACAGCTGTCGGGCAACCAGCGTTACATTGTACGTAATCTTGT
TTGTCGTCTCTGGACATGAGATCGAAGTGTTCATTTCGCCACCTGCGCTGGCGACATCAAATACGATTCCAGATTTCAACAAGGATATCTCTTCATACAT
TGTGGAATGGGACCTCGACTCAGCGTTCAAGCACGGACTTTCGGTGCGTCACTTCACTGACGAACTTTATGTTAGCGGTAACAACAGCACTTACGACACT
CCACGATTTCTGAACTGGGCTGTGTGCTAGAGGTATTCAAGGTCTTAAGTACGACAGTAGTGCAAGTTGATGGGCACCATACCTGCGACAACTTCAATAG
CCGCTCGTATTCCATCACATACTACACTTTCCCGCCAGAAGAAGTTGGCGGTGCACTTATCCAGAGCTCTCCGCCATTCCGTTACCGTTACCTGATACTA
AACCTCGTCGTCGCAATAAAGTATTTTGTGCGAGCTGCCGCGGTAAATTCAGTACCAGTGCAGCAGATTGCGCCGAACAGTGTTCCTCCTGACAATCGAC
AGTGGAGTACGCCCTTGAATAGGCAACGCCAGATATACTAGTATATGGGTTGACAGGGTGTATAAAGGTGC