Description :
From Genome Similarity Track
Location :
Scaffold_29:52769- 59987
Transcript NameFunction/comments
Physo_260080Eukaryotic/viral aspartic protease, active site

Sequence
7218 bases(100 bases per row)
TTCTCGCCGGATCCGTCAAACAAGACGCGACGAGTTCCGCGACGGGCCAAGACGCGCCGAGCCCCTCGGCGGGTCCAGCCCAGACTTCGACGACCACGCC
CTCGCCTCCACCTCGATACCAATCGAGCGTGGACTCCGACAGCAGTTTCGAGTCGCCCAAGCGCATGCCCATGAACCGGCCGCCGCGCATCATGCAGCTA
CCCGCGGCGCCCACACGCACAGAGGTGACGAAACCCGCCGAGGAGGTGCTTCCCAAGGCCTTGAGAGAATCTATCATCAGGCTGATGCAGACGACAGTGA
TGAACACCCCGCGCGCCGACACGGCCGCAATTTCGACGGGGCCGAAGCCGCCCTCGAATCCCACACCCACGGTGGCTCGCCCCCAGGAGGCAGCGGATGT
CGCCATGGAGTCGGTCAGTTCGCGTTCTTCGACGAGGTCCAGAACTCGACGCGACGCGGACGAGGCCACGATGACCTGTTCGACTTGGACATCGGAGTGC
CAAGAACCGCGGCCGCCGTCTCGACGGCGACAGCCGGCGGCGTAGCCCTCGCCCGCGTACGCCTCTCAGCATCTTCCGAACTGAAAGAGTTCTCGGGACG
GGACGCCAGCGAAGAGAAAGCCAGACTGTGGCTCAACCGTCTGAAGTCCGCCGCGCGGCGCGACGGGATGACGGGCGAAGAAGTGTGCGGGCAGTTCAGC
GATCTAATGAGCGGTCCTGCGCGCCAATGGTATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCGAGCTGATGGAGCAATTCCGGGTGCAGTACT
GCGGCAAGGGCGTGTCAATGGCCAGTCGCTACTACCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGATTACTTGTACCGGCTCAACGTCGCGGGCAT
GAGGGCCAACACCCCATACGCCGAGGGCACGACTGAAGAGAAGCGCGAACACGTCGAGCATTTCATCCGGACGCTGAACACGCAGGAGGCCGAACTCGCC
TCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCGACAACGTCGATTGGTTCACCAGAAAAAGACTCTCTTCG
GCTCAAACAAGTTCCGCCAAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATACGATTCACGTCGCGTCGGACGAGTACGACTCGGAACG
CGAAAGTTGCGACAGCGACGATCGCCAGTACGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTCGTCGCGGGACAGGCCCCGCCGGGAGAGCCG
GCGCGTCGCAACTTCGATCCCGACGACTCGGGACGCGACCGCCCGCGGTGTCGCCACTGTGGTTCACGTCGCCACGCCGAAGGAGACTGCTGGAAGTTGT
TGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTTCAAGGCCTGCGGTGACGTGCACTAAGCCGGAGAATGCCCGATGGA
GGAGTTCTTCAACCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCGGTAATGCTGCCGCCGACCCCCGAGAAGATGTTAAACTAGGACGCTCGCTGG
CTTGGGAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAGGTGGTTAGTGAGAGCCCGACTTCCCTGAATGA
TAATACATGTGAATCCAACCCGGAACGTACCACGCAAGAACGCGCGCCGCGAATCTCGGCGGTCCGACGTACGACGGACGACGAGTTTGCACGTGAACCA
CCCCTGGACGAGATCGACTTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATGGAAAGC
TGAACAACTGCCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGCTTGTGAGGTAGGCTGCCTGATTGACACGGA
GATCACGCAAGAGTGTGTGGGAATTCGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATTACCTTGGCTGGGAACTTGGTGTACTACATG
CACCTGTGGGTCGGCGACTTGGTCGGCCAACACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAGTGCGCATCGACACTGCGGATGGCACGGCGT
GCCTCCCCGATGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACGGCGCACGGATGCACCCGATCAACGTCTAGACGCCTGTGAGGCTCGAACC
ACGAGACACGCATGAAGTCTTGCTGAGGCCGGATCGAAATGCGCTGTTCCTGTGGGTGACACGGGCAGAGTCGTGGGTGACTACCTTTGTCAAGGGGAGA
GTCGGAAAGAAAACGTACCTGCGTGTCACGAACATCGGAGACGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGTGGACGCCGTCTGACGGCC
AGCCTCGGAACCGTGGATTCGTCCGACTGGGCTCCACCCGGTACCAGCAGTGGCAGAATCTGGCGTACGGCGCGACGCGCGACGCGGAGGAGAACTGGAT
CCCAGCCGAGCTCGACGGATCGATGACGGATCGCCCCTCATACCCGACGCCTAAGCCATCTTGCGCCCGGAGCCGAGACAACTCGGAACGCGACGCGCCG
TGGCCCCAGTGTTGGCGGCTGTCGCGGAAGCGCTGAAGGGAAGGGGGGTAGACTTGCCACCCGACGACCACAAGCCGGATACGGACGAGGAGGCGGTGGA
AAGCGAACCCGATATGCCTCCGACTGTGGCTGGAAGCGCTGCGATGGAAGAATCGCCGGAGTCGGAACTCGCCGAGCCAAAACTCGACGGACCAAACCCC
GCCGAGCCGAATTTCGGCGAGGCGAAACCTGATGAGCAGGAGGAAGACGACGCAGTCCTCATCCACGAGGGGTCCGACCTCTTCGTAGAGGATCTCGAGT
CTGAGATGGCAGTGCTGCCAGACCTCTCGCTGACCGCCGAGGTGAAGAACGAGGACTTGAAGGTCGGCATGCCGACTGGACTCCCGCCCGAGGAAGCCGC
GAGACAAGAAACGCGGCTACGCCAAATCATCTGGAAGCGACGGAAGTGGTTGATCGGCAAAGGCAACGCCTTGCCGCCGGCCGCCCTGGGTGTTGTCTGT
GACATCGACGTGGGCGACGCAAAACCCGTCGCGCAACGCGTCCGGAAAATCCCGCCGCAGTTTCGAGAGAAGGTCGCCGGCTTGATCAAAGGGCTGCTGA
GCGCGAAGATGATCCAGAAGTCGAAGTCGCCGTGGGCGTCGCCCATTGTCGTGATCATAAAGAAGAACGGCGTCGATATCCGGCTTTGCATTGACTACAG
GCTCATCAACGGGCTGACACAGTTGATGATTTACCTCATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCTCCATCGAC
ATGGCGAGCGGCTTCTGGGTCGTCCCCATGACAGACCGGGCCCGGCTCACCTCAGCCTTCATCACGCCGATGGGACTGTACGAATGTCTGCGTATGCCGT
TCGGCCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATGAAGCTGTCTCCGAATGGCAGCACTCGGTACGTCTT
TGAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGACGGAGGTCGTAGATCGACGACATCCTCATCGGGGGTACGTCGTGGGACGACCTG
TGCGAGAAGATCGAACGCTTGCTGGATGTCTGCGAGCAGTGGCACTTGTCCATCAGTGTCGAGAAGAGCGAGTGGGGCATGTCCAAGGGCGACTACCTGG
GCCACCGAGTCTCAGGACTCGGTCTCGAGGCGAAGCCGAAGAATCTGGAGTCACTGACGTCGCTCGAGTTCCCGCGCACGCTCAAGGGCCTGCAATCGTT
CTTGGGTAGCCTCAATTACTACCACCGGTTCATTGCAGACTTTGCGGTGTACGCAACCGCGCTGTATTCGCTGACGGAGACCGACTTCAGCGAGTACGTC
ACGCATCCAGAAGTCCGCGGACATGAGAAGTGGACGCACGCGACGCGCGCCTTCGACGCGCCCAAGGCAAAACTCGCCGAGACCCCAATGTTGAAGCACT
TCGACGCGAACCGAGAATCCGTCGTGATCGTGTACGCCAGCGACTGGGCCATCTCAGAGTGCTCACGCAGGTCCACGACGAAGTGTACATGCCTGTGAAG
TTCACCAGTCGTACGTTGAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGCCCTGTTGCGCGTCTTAAACGAGTGCTACACGATGC
TAGCAGGGAGACCGGTCCGCGTCTTGACACGTCACACGACACTCGCCTGGTTGTCCCGGTCCAAAGGACTACAGGGGCGACTGTCACAGTGGGCCGCGAT
CCTCTCGCCGTGGAAGTTGGAAATCTGCCGATCCATGAAGGGAGAAGAAGAACTCCTCGGCGCGCTGGCCGCGAGCATTACCCCGCGAGCCTTCGTCGAC
GCGGCGCTAGAAGAGATCGCCCCACGGAGACGGGCGTCCAGCATTGTAGTCATTCCAGTCCCCGACGTGGCGCGCGACGAGGTCTTGCACGTTTTGAGCT
TTGACGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCCGAACTGGGAGATCGTGCGCGCCGCGTCGGGATATGC
GACGGACCTCACGGTCAACGGGAGCTCGACGACGTCACCCGACTCGTCGTATGCGGAGACTCCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGACT
GCAAGTTCCCGGGGCTGAAGCTGCTGCGACAAAAGACGCGAAACGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCACGTAGGACGAGACTGGAACGC
GAGTGCCGACATGCTAGCTGGACATGCTCTGCAGCGTCAAGGAGGCCACAACGCGCACAGCCCCGAAGAGATTCAAGATCTGAAGACGCTGAATCGCTTG
GAAGAACTCATCCGACCACGGGCATCGAGTCCCGGGATGGCGTCTCCAGCGAGTCCCGACGCGGATAATCTCGACGCAGAAAACCTGGACTCGGAAAATC
GCGACGCGAAAACGCGCGGCGCAAATGACCCCGCCGGGAAGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCGCGCTGTGACGACGCGCTCGGCTGC
CGCACGCACGACAAAACGTAGGGTCCGACCTCCAGAAGTCCTGGAGGAGCTGGTGGTGCAACGACTGCGCCTGGACTGCATCCGTGTCGCCCAGGACGAA
GAGGTCTGGATCGTCAACCTCAATAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCGCCTCAGTACG
AAGAGGGCGAAGGCGGGCTGCTCTACTACCAGCCGAGAAGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCTAGAGACTCTTCG
GGAAGATGTACTCCACCACTGTCACGCGAGCCTGGAAGGCGGACACCAGGGTATTGGCCGCACGTACCAACGCGTAAGGCGCCACTTCCATTGGCCAGGG
ATCTTCAGAAGCGTCCAGCGCTACGTCGGCGAATGCACCGACTGCGAGACCGGAAAGGGTCGGCCGACCATCCAGGGCGAGTTGCCGGGCAACATCGTCG
CGACGTACCCGTTCCAGGTCATTGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGCGTCGACCTCTTCAC
GGGGTTCGTCGTGGTCAAAGCGAATGCAACACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGACGCTTCGGCGCGAGCGAGGCT
ATCCGCCACGACCGCGAGCCGGGCTTCATGTCCGGCTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAGCGAGCGACGCTTGCTTATCGTCCCC
AAGCCAACGGTGCTGCAGAACGGATGGTGCAGACGGTTACAAGAGCGATCAAGATGTACATCGCAGACGTCGACCAACGCGACTGGGACGAATACGCCGA
GCGTCTTACCTTCGCGCTAAACACGTCGCATGACCGGACGAGGAATGAAACCCCGTTCTTCTTAGTGCACGGCTGGGATCCTCGAGCAACGCTGGAAGCG
ACGCTGGCCGTCGGGAACACGTCGACCCGGGACGCCGAGGCGAGGCGGTGGAGGCTCCGTATCCAGCGACACTACAAGGTGGCAAGGGCACAAGCGTTGG
AGTTAGTCCGAGAAGCCGTCGAAGAGAGAGCGCGTCGACAAACTGAAAATGCGACGTGACATGAGATCGCGACGGGCTCGCAAGTTTGGCTGTACCTGGA
TCGGGTGAAGCCGGGGTATGCGCGCAAACTCGCGCACATGCGGCACGGACCCTTCCGCGTCGCCGAGCTGGTCAGCGCGTTCGCAGTGCGCCTCGAGACG
ACGGGTACGCCCTATCAGCTGTACCCCATCGTCCACATCTCCAAGCTGAAGCCCGTCCGGGAATTCCCGTCGCGACCCGCGACGCAGATGACGGTGCCGG
CCGAGGAGCGCTTCGACTTCGACGAGGAGCTCTTGCCGGAGGATAGCTGGGAAGCCACGCGCGAGCTGGAAGACGACGTCTTCGAGGTCGAGAAGATCGT
GAATGTGCGCGAGGGGCGGGCTACCCGGTATGGGCGCACGCGACGCGAGTTCGAAGTCAAATGGAAAGGCTACCCGGACACGACGTGGGTCGACGAGCTC
GATCTGAATTGCGGCGGGTTGCTGTACGACTTCCTGCGCCAGCGCACGGGACGCAACCGGTTCGAGGCGATGCAGTCGCANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN