Description :
From Genome Similarity Track
Location :
contig_6:527688- 529059
Transcript NameFunction/comments
g2166.t1hypothetical protein

Sequence
1371 bases(100 bases per row)
GCGCATAATAATTAAGCGAGGCGAAGTCTTTCCAGCAATGCGAATTGCGAAATGACTCTCTGTCACGGCCAGCGAACCGGCTCGTGGTGGCCATGCTGAA
TGATTTCACCAAGAAGGAGGGTTTCTTGCCTGGCTTTTAGTGAATGCCCGTTTTATTGTAGTACACATCTATTATTAAAATAATAATATATGCGTGTTAA
TAGCGTACATCTGACGGTTAAATCCGATGGCAAATACTAGTATCTTTTTTTAAAATTTAAATCTGTACCTTGCTGGTTTCTTTTTGCTGACAGAGATGTT
TGCAGCGGCTACATCGTTAGTTCTACATGTACTGGACTTTCAAGTAAGGTTACTTGGATATTTTAAATAATAGCTCACGCCAGCTGACAGCCCAAATACA
GATCAAAGTAGTCCTTGAGTTTCGTAATTAAGTGCATCATCACCTTTCAGTGTGGCCCTCGGCTTTCCTCCTCAGTGTCACCTTCGCGTACACTTCGGTC
CTCTTTGATTCAGCCCTAATTTGACCGCAAACCACAATTTCGTGCACTGTAGTTGACAAGCAATTTACTGAACGTTTCACGGTTTGGTTTATTCAGGGTG
TTATTATAATTAGTAAGCTTAGAATACCCCTCACTGCCATTGTTGACCATCCGTTCCTGTATTCCCCCATCTGACGCAGCTGAACCCACAAGAATATCGC
CTTTACATGCAAGTCATTTGAGGCTCAAACGACTTGCATTTTACGGCTCAAATGAGCCGTTAAATTCTTGAGCTTCCTCAACCTTCGCCAGTGACAGCTG
TCGGGCAACCAGCGTTACATTGTACGTAATCTTGTTTGTCGTCTCTGGACATGAGATCGAAGTGTTCATTTCGCCACCTGCGCTGGCGACATCAAATACG
ATTCCAGATTTCAACAAGGATATCTCTTCGTACATTGTGCAATGGGACCTCGACTCAACGCTCAAGCACGGACTTTCGGTATGCACTGGATGCGTCACTT
CACTGACGAACTTTATGTTAGCGGTAACAACAGCACTTACGACACTCTACGATTTCTGAACTGGGCTGTGTGCTAGAGGTATTCAAGGTCTTAAGTACGA
CAGTAGTGCAAGTTGATGGGCACCATACCTGCGACAACTTCAATAGCCGCTCGTATTCCATCACATACTACACTTTCCCGCCAGAAGAAGTTGGCGGTGC
ACTTATCCAGAGCTCTCCGCCATTCCGTTACCGTTACCTGATACTAAACCTCGTCGTCGCAATAAAGTATTTTGTGCGAGCTGCCGCGGTAAATTCAGTA
CCAGTGCAGCAGATTGCGCCGAACAGTGTTCCTCCTGACAATCGACAGTGGAGTACGCCCTTGAATAGGCA