Description :
From Genome Similarity Track
Location :
Scaffold_36:527679- 535594
Transcript NameFunction/comments
Phyin_T30-4PITG_14640Putative uncharacterized protein
Phyin_T30-4PITG_14641Glutathione peroxidase
Phyin_T30-4PITG_14642GDP-L-fucose synthetase
Phyin_T30-4PITG_14643Putative uncharacterized protein
Phyin_T30-4PITG_14644AMP-binding enzyme%2C putative

Sequence
7915 bases(100 bases per row)
CTACTCGTCGTTCTCGCAGGTTTAGCGGGCGACTTGCTAAACTTTGCCTGGAATGACTGGAACGGCGACTTGGCTGCTCTCACAGCCTTCGCAGCTTTGG
CTGCAGGAGCAACTTCCACCTGGTCCAACGCGGACGATAGTAGCGGCGGGTGTCCATTGATCCTCGTCGAAGTAGCAGCAGCATCTGTGGAGGTATCGTC
GAACATCAGTGGTCTCTTAGGCGACGCTGACGCTCGGTGCCTCAATGGACTCGTCAGAAAATCGCTACGTCGGAGCGGACTCGCCGTGTTCCCGCTGCGC
TTCGGTCTGGCCGGACTGGCCAATACTGAGCTTCTCGGTGGTCGCACAGGACTCGAAAGATGTAGCGGGTTCACGCCTCTAGCCCGCGCTGGACTCGCTT
GCTGTGGTACGGGGCTTTTCAAGTTGAGCGGGTGATTGTGACGTCGTGCGGGGCTCGTAAAGTTCGGTCCAGACGCCGTAGGAGCACGTCGAGCAGGAGA
CAGGATGCCTGCAGCGACCGCTGTCCTGGCTGCTGCGTCTCCGTGCGGGGGTGACGTCTTCTGGCGCTTAGCGGAGCGCTCAACCTCGTCCACTTTGACC
CCAGGCGTGTCCTCTTGTTGCTGACGCTTTTTCTTGAATGACTCGAGGATCTGCTGCGCGCGGTTCTTGGTGCTGTTGCGCGAAGCTGCCACGTTCTTCA
TGATCATCTTCTCCATGTTCATGCGGTTGCGTCGCACCTGGTCGCTGCCGCTGCGCGCCGCCGCCTTCTTGGGCAGGAGCTGGGTGGGCACCACCGGGCG
CGGGTTGCCATTAGAAGAGTGATGGTCATCGTCCTGCGACGCCATGAGTGCCCACGATTGTTGCTCCCTGGCAGGTGCGCGCGCTTTTGAACCAAAACCC
TTCCGCGCCATTTTAGACTGTACGTTCATTGGTCAATAATTTAAAATATCTTTGTTTTAGCCAATGAGATCAAATATGACATTGGTGTTGAGTCATCTTG
CCGTAGGAGATCCGATAAAAATGCGTGCTCTGTTGTTGCTGGCGGTGACGCTGGCCGTTGCTCTTCTTGGCATCTGCAATGGAGAAGTGAAGTCGTTCCT
AGACTTTACGATTCCGGATCTTAAGGGTCATCAGGTATCCATGCGTGAGTTCAACGCCTTCCCGGTCATTCTCGTGGTCAACGTGGCCAGCGACTGCGGA
TACACGGACAAGAACTATCGTGAGCTTCAGGTACGATGCAGTGGAACACTCGGTCATTTCTTCTGCGTCGAGTTGAACGAGCTAATAGCAAAACATTTTG
TGCTATCGCGCAGGAATTGTACGAGAAATATCACGATGAAGGCTTCATGGTGCTGGGCTTCCCGTGCAACCAGTTCGGCGGGCAGGAGCCTGGAACTGCT
GAAGATATCCTTAAGTTTGCACAGGAGAAATACCACGTGACGTTTCCGCTTTTTAACAAGGTCGGTAGCTATGGTGAAAATCACCTCAATGGACTGCTAG
ACTCTGATTACTTTGCTGGCTTGTGGTGTTTAGGTGGACGTGAATGGTGAAAACGCTCATCCGCTTTTTAACTTTTTGAAGAAGAAGCTTGACGGATTCA
TCACCAACGACATCAAGTGGAACTTCACCAAATTTTTGATTGTGAACCATGAGCCATCCAAGCGGTACGGGACGTCGACATCGCCATTGGAGATTGAAAG
CGACATTGTGCAGGCATTGCACAGCAGCCGACACGTAGACCAGTTCGACGATGGTGGCGCGACGGATGGCGACTACGGAGATGCTCACGATGAGTTGTAA
GAGATGCAGCTGGCAATATTCAGCAGTCCTTGGTTACCGTTTACCAGTTGAAAACCACAGGTGCCAGCACTGCAGTACTTTGAAGTAGTTTAAAACACGT
TTGAAGCCTTTGCCCAGGCCATTCGTATGCAGGGCCACTTGCGTAATTTACTACGTAGTACAAGCTTGCTTCAATGAGTAGTGGGGAATGGTAGAGGGTA
GTACCTAACGTCTTTCGGTTGGTTGTGGCTAACGGCTGACATGTGAGCGGGAGAGCAATGTGCGATAGAATCGTCAGACTACTTCATTATGTGTGGAGTA
CTTTAATATTTTGTAGGCTTGCCACTATTTGCGTGCCTTTTCATAGTTTGCCTCGAGCCATGCACTTGTCTGCTGCAAGCCTTTGCTGATCGGTGTGAAC
TGGAAATCTGGTAACAAACTTCGCAGCTTCGCGTTGCTCGCCGTCTTCTTGAACTGACCGTCCGCTTTGCTAGAGTCGAACATAATTTCCCCTCTGAAGT
CCATCGCAGCAGCGATCTCTTGTGCCACGTTACCAATCGACACCTCGTCCTCTTCGCCCACAGATAAAATCAGTGGCTCCACACTGTTGTAGTGGTCCAA
CGTCCATAGCATGAGCCTTGCCACGTCAAGACTGTAGATGAACTGCCTCAGCGGCTTGCCACTTCCCCAGATGGCGAACGGTGTCAAGTCTCGCTTAGCC
AAGTAGCATTTGTGAATTAGTCCGGGCACTACGTGTCCGTTGTCAATGTTGAAGTTGTCGTGTGGTCCATAGATGTTGGTAGGGATGACAGACGTGAAGT
TGCATCCAAACTGGTCCGCGTAGCAGCGGTTAAGTGTATCGATAAGTCTCTTAGCCATGGCGTAGCCCTCATTGGAGTTGTGCGCTCGACCGTTGTGTAG
CATCGTCTCGTCCAGCGGATACGAAGTCTCGACTGGGAAGACGCAAGTGGAGAGACACGACACGAGCTTTTCCACGTGAAATTGCTGGCAGCATTGCAGC
ACCGAGTCGTTGATGGCCATGTTCTCTCGAAAGAAGTCCACTTTCCTCGACAAGTTGTGAAACAGACCACCTACGAGCGCCGCCAGATGCAGCACGTGCG
TGGGTTGCACACGTTCGAAGAGCTTGCGAGTCTGCTGTGGGTCGCGTAGATCCGCGTCTTTTGAGCCCACAAAATGCCACTCGTCTCGGGATGAACCTTG
GGTTGCTACGATGTCCTGCAACGCTCGACCCACGAGTCCCGTGCCGCCAGTGACCAGCATCACACGTCGACGGCTGTCGTCGTCCATGCTTTAAGATCCG
AAATCATTTTAAATATTTGAGGTAAAATTCAATTATTTATTATCAGAGGTTCATTTGAAGGTTATTTTACAATTAACCTTTTTCACGACTTCCATTCTGA
AGCCTTCACGCATCTGAGGAATGCTTCACTGAAGCAGCTTGGGAATTATGATTGACCAGTTTATCCAGCAAGGTCCGGCTGACATACCGAGAGCTGGTGT
GCTGGTTGTGGTTGCTTGAGTGAGCGCGGCACAGCTGGACACGCCGTTGCTATTAGCTTTCCCAGCTTCTGATGTCCCTGCTCACAGAGCTTTCTACCGT
TAGGATCTCACCGCTCCTAATCTCTCATGATCTCGTAAGGCAACTTGCCTTAGGCAAGTCAGTTGGGTAATACCGCACTTCAAAAGTTTCAGCTTATTAG
TCTTTGCTACCAACAAAAGGATATTTCGTCCACTTTTGAGTTTAGCGTTGGACTTACTCCTTACCTACCGTCTAGGTCAACCGTTATGTTACTGCTTCGC
CACTTCGGAAACGTCCCGGTTAAGATACTGCAGCATCGAGTCTTCGTAGATCTTGACGTCTTTGAACCCCATCACCTGCTCTAGTGCAAATGCCGTGTGA
GCAGCTCGAATTCCACGTTGGCAGTACGTGATCACTGGTTTCGCCTTGTCAAGATGGAAAATGTCCATGAACACCTTGTCGAGCTCTTCCTTGGTCTTGA
ACTTTCCGTTCTGAGTGAAATCCACGCCTTCCATCCAATTAAAGTTCACAGCTCCGGGGACGTGACCAGTCCGTGCGTTGCCGTTGGCATCCTCTCCCCA
GTACTCGCCAGGGGATCTGGCGTCCACAAACTGCGTGGAGGGATCAGCGATCCCTTTCTGCACAGCTTTAAAGCCGACAAGCTTCTTAGTGTCCACAGGT
TGCGTCCAGAGATCTGAGGGCGTTTCCCGGGCTTCAGGTTCTCCTGTCTCTACTGTGTTATCGTCAGAAACCCACTCTTTGACACCTCCGTCCAGCACCT
TAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACTGTGTTTATTAAGTCCTGAAAAA
AATATTGGTAAATAGTGTTTTTAAAAACAATTTTCATGAAACGACGAGTTTTGTGACTTCCACCTACTTCAAGTATTATTTAAGAATTGAAATATCTAAA
TATTATCGCTCTAATAGTATTGTGCACCACTAGTAGTAGTACAATTTGTATTTTTACACACAATATGGATAAAAAAAATAAACCTTTTTACCTAAAGCGA
AGCGTAATTCACTCATGAAGCGCACATTATCATAGTGCTGAGTGGTTAAGCATACTAATAATTGCACACGCTTGGGCGTGGTGGGCAAATGAGTACGTGC
ATTTTGACCTAGGTCGTTCGGCCCAAAACACCCGCACGTAGTTCGAGTGTGGTCCATTATGTCATTCACAGAGCTGTTTAGAGTGTTCATTTGAGGGGGC
GGGTATTATTCATAACCTTTCATTGATATGGAATGGGCCTTGCATCTCACTACATGTAGTTATCCTTGTAGCAATGTGTTGCCGTATCTGTCGCGCTACC
ACGTCTACGCTGGGGTGCCGTAACATCGTTAGATGCGTGCAGTCTGAAATGGTAGATACAGCTGTGATATCAATTCCAAGTGCTCGATACAGCGAGATGT
CTGCGCTCCACCGCTGCGTCATGTACAAGTCAGCTTGGAGCCACACTGGCGGCTGTGAACTGGAACACGCAGTCTCCACTTCCGCCGTTGTGTACGGCTG
GTACATCTCTTCCATGGCGCAAAAGTGGATATAGTTGTCTCCTAATGGACGTAGCAGGGCGTCTCCGAATGCTTCATTCGTATACTGTTCAATGCGAAGT
CGAGTCGCAGTCGCTTCCTCCTCGGTAACTTGCTTGGAGCTCGGCATCTCGAATGGTAGGCCGTCCAGCAGAATAAGAGGCACAAGTTCGTGTCCCTCTC
TCACCGCTAAGCGTGCTACTTCGTGGGCTACACGGCAGCCGAACGAGAAGCCTCCGAGAGCATACGGACCTTCGTTCTGACGAGTACGGATACTATTCCA
GTAGAATTTAGCGAGTTCTTCAAGACTAGAAAACTGCGAGTTGGTTGCTTGAACTCCGACGACCGCAAGCGGCAATTGTCGAGCTAGTTCCAGCAGGTTC
CAGACAGTCCCGTCAGCGTCATGAAACAGGAAAACTGTGCGTGTATTCTTCGCTGTGGGCCAGTTAAGTGGCACTAGCGTCTCCGATGTCCACTGACGTA
AATCCACCATCGAAGCTGCAGCCCTTCGAGCCATTTCAGGCAGCGATGACGTGCGGAAGAACTGCTCAAGGGCTAAGGAGAGTCCCCGTGCTTGCGCAAG
AGCAATCGCTCGGATAGCCGCCAGCGAATCGCCACCCAGTTCGAAGAAAGACTTGGACATTAAGTTCGCTTCGAGTTTGTCGTCCATGTCTTGGTCACCA
TCCACAGGCTGGAGCTCTAGAGCCTGCATCCACACCTGCCGTAAAATGTCCGTAGCTAACTGTACTGTAATAGTAGACTCTTTCTTTTGTTCTCCAGGAC
GAGAGTCTGTCGAGTTTGAGCCAGCCCAACTTGCGAGCGTTCGAAGATCGATCTTCCCGTTTGGTGTGCGTGGCCAGCTACTGACAACTTGAATCGACTG
AGGCACCATGTGAAGTGGAAGGTGCTGGTCAAGATACGCGCGTAACTCGGTTAAATAACCGTCTCGGACCGATAATTCGTCGATACTCTCAGCTGGCATG
ACGAAAGCTACGAGCGTCGACGACATTTGCCGTTGCTTCTGACCGGGCGAGGTCAACTGAGGAACTGAGAGCACCTCAGCTGCCTTGATGCTTGAAGAGC
GCAGTAGAATGTTGCGCACTTCTTGTAGCTCGACTCGCATCCCATGAAGCTTCACTTGTGCATCTGTGCGTCCGAGAAACACCAACTCGCCACTAGGTAG
CCATTTCACCAAATCCCCAGTTTTGTACCATCTTCGTGTTCGCTTCTGAGCTAGTGACGCGATTTCTTCGAGTTTTTTGTGAAGAACGAACGAGTTCTCG
GTGAGTTCTGGACGACGCCAATAGCCACGAGCCACCCCTGCTCCACCAATGTACAACTCACCAGGGACGTTCACTGGAACGAGTCTTCTCTGAGCATCCA
GCACTACCACCGGATGCTCGTCTATCGGTTTTCCGATGGGTACACTATGAAGTCCTTGAAAAAGACTTGACTCGTTCTGCATCGCCAGTTCTCGAGGCAT
CCGAAAAGCTGTCGAAGTTATCGACGCCTCAGTGGGTCCGTATTCATTGACAAGACACGTAGAACAGGCCGGGTGTTTCTTGTAGAATTGACGTGCAAGT
TCAATGGGAAAAGCCTCACCCGCCAGTATAACGTGCTTGATGGAAGCTGGAAAAGTATCACCGTTTTCACTCATATAGTCCACGATCAGCGAGAAATATG
ACGGCACAAATACACAAAACGAGATGTGAGGAGCTTCCAGCAGCACATTTCGCATGTACTGCAGATCGTGGAGCCCCTTTGGACGAGTGATTCGTGCGCT
TCCGCCAACGAGTAAAGGCGAAAAAAGTTGAGATAACGAGCCGTCCAGAGTCGTCGATGTGCTCTGGAGGAAAACGTCACTTGACGTCACTTCATACGTG
CGTACAGTCCACCAAAGAGTTGTCATTAAAGCAGCGTGAGGCACTACAACGCCCTTCGGATCACCTGTCGACTAATATTTATGGTTAGTAAAAGAAAGGA
TCACAATAAGAAAAAAATACCGTACCCCAGAGGTGTAGAGGATGTAAGCAGTTGCTGTATCGGGGTCTAGCTTCTGTCTCTTCAGAAGCCTCGATTCGCT
GTCAAACTCGTCATCTCTTGCACATCCATCGCTAGACGAGGTTAGACGATCTACATCTTCGTAGTTTAAAACTCGTGGGGCAAGTTCTTCCTCTGACTCT
CGTGACGACACAAACGCAGCGATCTCTGCGTGTTTCCGTTGCGTGATGATCACTTGAAGTTCGCTGTCACGAGTCATATAACGCAGACGCTCACGAGGAA
ACTCGGGGTCAAGCGGCACAAAAACTGCCCCCCAAACCGCATATTTCCGATCATGGCTGCAACATTTTCCACTCCTCGATCCAAGAGCAGACCGATATGA
AGCTCAGCGGAACAACCAGAGATATCCAGCATGCACAAGGCTCTGGTGACGCGGCAGCTGTACTTCCACAAGTCCTGGTATGTCCACTGCGTGCCCTCAA
AGTGAAGGGCTGGGTGATCCGGGGTTTTCCACACTTGAGCAAGCAAACATTCGTCTAGAAACTCTGAAGGCGGTCTAAGTAAAGCTGGAGGCCTTGGCAT
ACCCCATACAGAGAC