Description :
From Genome Similarity Track
Location :
Scaffold_26:527610- 529110
Sequence
1500 bases(100 bases per row)
acattggagacaagcagttcaaagtgacgcgtaatggggcccagaaagcaaaaggtagacatgattcacgacgcgtgatgcacgcgtttaacgagagttg
ggatcgaacgcaagctgaaattgatttagcactcgcaaagagaaatgcatacgcagatcggttttacgaaaacgatcacgaataattgagagtgtagcaa
gtgcagtactcagcgtgagcagctctagctgccgtttgattcattgtgcatccacttcgccatttcgccgtagaaaccagccgtagcttggtgcaaaccc
gcaatactggtcaacagtgcatcgctgttggcttgttgctttgcattcgactcgacaatcgacgacgacagcttttgaaccagccgagatatctccccat
tgtcttgagacagctggtgacgagccgaaaaaacacgttcaattgtttcaaaccccgtcttgagcgtatcactcactacatctaccggtcgttttgtgga
aacgttgttagagattgcttgtcacgttgtttctttgctttagccgctgccttcgctttttcacgagcctcggttggtgattcacatgaatcatagtcca
cgttatcatctccagcgtgatcatcttcatcattttcgctcgtaggtagactaactctagctgggacgccagtctccatgaaagcttcacccgtgcagcc
aggtcgacgcgaaaacacatcacacagcatgctgcgagatctgcgccaagttccttcagataggtcggatgcactgacgtgggcttgcacgtcaacttgc
gccctccgccgctttcggcagaattactatctgaagattcgtcaggcttatcgacataaaaatccacagacatttctgtatatttgcgcaaggtgtcatc
tctctcgtcactactggagttggaatttggagggtgatttcctgtggcaagcatacggcatctctttgccttgtatgcggctcgaacagcatccagctta
atcttgaacggcttgacagtcacatcgcgagagttcatcgtcaccccacgcgtactccatcagggcgcgctgctgaaatacagtgatagtgtcctcccac
attgcacgttgggctgtcgtgttcgagttctttgtagcaaacttttttaggatctgcttgttttgaaaacgagcttcaatcgccaaagccgtcaattgaa
cggtccacttcatcgtcttaacatccgtcgtatcagctttcttctcgcccttccgaccacccttggtttttttgctagcgcgttttgcattcggttcgga
ggtagacttcgtcgtggtttgcaaagcctcggttgcgaccttgtccacgctgattgcagaggacttgcgcatacccgccatcttaggcttaggtgtcctg
cgagttgttggcttagctggtgttccatcgcccacatgcttggcagagttacgagcttttgccttggatgcagccggcttggacttggtggaagtgtctt