Description :
From Genome Similarity Track
Location :
Scaffold_240:5276- 11184
Transcript NameFunction/comments
Physo_144673reverse transcriptase

Sequence
5908 bases(100 bases per row)
TGCCGCTGTGCGAGATCCGATAACGCTGTCGCTGTGGAGATCAATGCGTTAGTGATGCAACATCAACAACCTCAGCACTTGGGACGACTTACCACCGTCT
TGCGCCTTCTTCGACGCCGCCGCCGCTTCTCGTCGTGCTACTTCTGCGTCCTCACGAGCTTTGGACGCATCCAAGCGAAGGGCGTCCATCCGTGGCGCTG
CTTTGTTGACCAGCGTGCGCGATTGCGCCAACTCGGTCTGCAACCTGTCGATTGTCGCCTCCGCTTGGCGCAATTGATTGCGAGATCTGTCTCGTTCGGC
ATTGGATCGTTGCAGGGCACATCCCGCGCGTCCGTCACTAGTCCGATCATCATCAGTGGCAGCTTCGCTGGCAGTCAACAGTCGGCCCCCTGGGGTCACC
GATGCAGTGGGAGGAGGGGTCCAGGTAGCCTTGATATCTGCCAGCTCGGCTCGTAGATCATCCGTCCTTCTCCGAGGGCGATCTCCAACTGACTGGGGAC
GACGTTAGAGGGCGATGCTGCAGCGGACGGAGTGACTTCATCGGCATCAGCTGAGCGAGCGGCGACCCGTGCGAGATCTGCGCGTACTTGTTGTTCAGCA
GCTTCGGCTTGCTGACGGTGTTCTACTTCGGTGTTCAGGGCCTGCTGGGGATCCCGGAGACGACCATCGACTTCGTTGCGCACGCGTTGAACCTCCAGAT
CGCGATCATGGATGGTTCGATGAAGACTTGCAGTGTGGCAACCAGATGCTTCAAAAAGATCCTGGGCGACGTCAAGACGGCCCCGGAGATCCAGCACCTC
GTGATCGAGGGCCGCGGTGACTTGAGCAGCCTGGATAATGCGCGCGCGTTCCGATAGAGATGGCTGCGAACCGGAGTATGGAGCCGCGGCCGGTATAGAT
CGACCAAGGGAGTGACAGGCGGTGCAATCTCCGTGGCTGTAGGTTGACGACGGGGCAGCACTCAGCCGAGGGACGCCGGCGGCCGACGACAAAGGCGACG
GCGTGGGTGGAGCAGCAACCATGGTGCAGGAGCTCTACGCGTGGCAGCCACCTGCTCGATGGCCTCACGCGAAGAGAGGGCGGATGTCGTAATGCAGGTT
GAAGGATTGTGAGGCGATGGACCCGGAGGTTACCCGAGAGTGAGCCACTTGAATTATGGGACACCCTAGCTCGGCGTCCCGTATAGAAGGCCGGCGACTG
ATTACGAAACCCGATGGCGTATTTACGGAGATCCAGAACGGGGAGGCCCGTAACAAGGACGATGACACTGCACGGAGACAGCAGATGACATCATGAGGTA
AAGGCGTGCAGCATACTGGTTGGTTGGTTGGCCGGCAGACGAGCCGCCGGTAGATAGGCAGTTCAGTTCAGAATAAAAGGAAGAACACTTGAGCAGTAGT
TGGCAAAATGCAAAGTGATTCGATTCAGGTTCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCTGCTACTGGATACCTCTTACTGGATACACCCTACTGG
ATTCTCTACTGGATACACAGTTACCTTATCCAATCAGAGAACGCCACGTCGATGCCCATCTTGTACCCACAATCCTGTACCCACAATCATGGCGTAATCA
CCCTGACGTAATCATCGTCCCGTAATCACCTGAATGATTGCGGTACAACACAGTGAAGGTCACGCCAACCTCACTGATGACGCGTTCGCGTCACACGGTC
GCTTGGCGAGGCGTCGTCACATCAGTCTTGACAACAAGAATTTCCAACAACGAGACAAGGTACTTCTTCATATTAGTCTTTGTGTTGTGCGGTTAGCGCC
TACGTGTGTACTGTGACTGTTTCCTACCTACTTGCGAAGTGTACTCGGGGTTCTGGATTGATTTGGCCTCCCCGGTAACCTTCTAGTAGCGTAGTGTGTT
GCATTGTCTGGACTCAGGAGATCAGCTCTCAGTGTTCGACAGTAGGACACTCTAAACGGTTTAGTAAGGTATTGGTGTGCGTCTCGCACTTTGGTTTGGA
CCCGCAGACTAGCTGCGGCAGGATATCTCCAATAGATCTCGTACATATTGTACAACAAGTTGTCGTACAGTGGGAAGAGTTACCTCGCTGTACAAGTGCA
TCCGCGACAGAGTTAACCTAAGTCTCTGCCTGCGAGTGTAAGGAACCCCATATTCGCCCCTTCATATTACACGTCTTCTAGGAATTACGCTAGATAAAGA
TCCGAGTCTTGCTACAAGGGTACACAAGGTGAAGCCTAGAGATCTCGGGACTAGTTCTCGTTGTCTTTGGGTATTTGGCTTGCAGGGGTAACCCCCCCCC
CGTAGTTGCGTGGCAGGACACGTGTGGGAGTTTATTAGTTTTTATCTGAGGGACTGCACCACAGTTCCTTCGCTCTCCGTTGCTTCTCCTTCAACTGGAA
CTCGGCTGCAAGCTTCGAAGCCACCTCTCTCTGTCGGTTTGCTTCCCTGCGCCATTCGGCTGCCCCTGCCGAGCCTGACTGACTTGGTCATCGCCTTGAG
TGTAGACCGAGCGTCCCATCCGTGTACCAGGTAGAACGGGGTCTCCCGCCGAGTCGAGTCTCTCGAATTGTTGATGGCATGGACGAGCTTCTCGGCTACG
TCATCCCAGTCGGCTTGGAGAGGGTCTTCCACGTACACACGCACAGTCTGGATCATGGTCTTCACCGAGCGTTCTTGCTGACCGTTGGCTTGTGGTCGAT
AACTCAGCGTCGCTCTCGACTTGGACTGCATCATCTCCGAGAACTTCTGGAACACTTCACTCATGAACTGGGGATCTCTGTCGTGGCGTACCAGTGATGG
AGCTCCAAACCTCCGGAACACGTTCTCTTCGAAGGCCTTCGCTACCTCAAGTGCCCCAGTCTCACTCATCGCCTTAGCAATCACGAACCCGGTGAAGTGG
TCTTGAAACAACAGGAGTGCAGTATTGCCCCGCCGAGTCTTTGGCAGTGGTATGACAAAGTCCATCGATACCACGTGGAACGGTCGCTCGGACACCACGT
TGCCGGGTGAATAGCCCTTCAGGTGCGGTTTGCTCTTACTGGTACTGCAGTCTTCGCACGCTTGGACATGTTTGACCACGTCTGCGTACAACCCAATCCA
GTAGTAGTCGGCTCTGACCCTGTGGTATGTCCGCACGATCCCTTGGTGGCCTCCCTCGATGGAGTTGTAGCAGTTCTGCAGGATCTCGTCTATCATGGTC
GTCGGAACCACCAGTCGAAGGGATAAGCCCAGTTCGCCGAGTTCGCCAGGTGGTCTGGCCTTGCCTTTTCGGTACAGTAGCCAGTCTTCGGTGAGGACAA
ACTCGTCGGCAACTTTCCCTGCGTTGTGAGCTCGGCGATGTGTGAGCTGCGCATAATTGATGGAAGGTATGGATCTTGGACACGAAGCTCGGACGAAGCG
GAGGGAGGGACGTCGCAGACGGCGGGACCGGAGCGAAGGCACTTGAGGGGTAGAATGAAGATTCGAAAGTGATTGAATTGTTGGAGCTTACATCCTACTG
TTATAGACACGCGACCCTGCGTCCTATCACCTAGTGCATCTAATCAACCATCACTCACCGGTGTTCATCCAATCATCCTACTCGTCTAATCATCGGTGGC
GTAAACAACTTACCGTAATCACCATAATCAACGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTAATGGGTACAACTGGTACACAGTACCCAAGAC
CAGCAACCCTCAATACGCCCCCTCAATGCGAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCGAGAACGTCTCG
GTGTAGTCAATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCC
ACTTGGTATCGATGGCGCGTTGTCCGTTAGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCTTTGCGCCA
GTGCACTTGATCAGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATAGATCGGCTGCTGCTTCCACAGCGTTGGCACTGGCACGCCAAAACACT
GGAGGCGTCGAGTCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGTCGGGGTCGGCTCGGCGCGAGGAGGATACGTCCGGCGCACTTGCTTCTT
CTAAGCCAGCTCGGTGGCGAACGGGGCGCGATCTTCTGGCAGTGTTGTCGTCGCCACTCGGTCGGTACTTGCGCTTCCCCGCCTGCTTGAAGCTCGTTTG
GCGCGGTCCATCGTTGTCGTCCAGGTCCAGCGCGTCCAAGTCCAGCACAGCATCATCGAAGTCTTCATCCGAAGTATGCGTCGAAAGTCCAAAGGTCGAC
TCATCGAAGTTGACATCGCGACTGATAACCACCTGCCCCACCTCGATGTCATAAACTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAGCCCGG
CGCGAGCCTTGGGGTCCCACTTGCGCCGTCTTTCCTTCGGCGTCAGGATGTACGTCTGGCATCCGAACACACGCATGTGCTTCACACTCGGCTTGGACTT
GTAAACGATCTCGAACGGAGTCTTGTGTTCGATCTTGGGTGATGGCAGACGATTCTTCACGTAGATGGCTGTCATGGCCGCCTCAGCCCAGAAGCTCTTG
TCCAGCTTGGCGTGATGCAGCATGCTGCGGCCAATCGTGACGATGATCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGG
TTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTAGTCGCGAACTCACGGGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAA
CTGCGTCTGCACCTTCGTGACGTACATCTTGATGCAGTCCTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACG
ATCAGCAGCAGATACTTGCTGCCACCCAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGCGCTGCTCATCTCCAAGTTCAGCACGACGTTCTCGTAGCTCTTTGGGGAGGCTGCGCAACAGGCA
GATCGCCACGTCCTCATCCTCCATCTTGGCGCCGATGCTGCTGAGCTTGGCGCTGATGTTGAGGACCTCGTTGCAATGATGCAAGACGTTGCCGCCTTCC
GACATCTC