Description :
From Genome Similarity Track
Location :
contig_14:527453- 529183
Transcript NameFunction/comments
g3594.t1XP_008915142.1 hypothetical protein PPTG_18798 [Phytophthora parasitica INRA-310
g3595.t1hypothetical protein

Sequence
1730 bases(100 bases per row)
CACGGTCCACTCGCTTTCGGGGATATCCTCGAGCGATGCGTCGCCGTAGTATGGGTCTCCCAGTGGAACGACAGCCATGATCAAGCAGCAAACAAAGGCC
AAGGCCCAACCAATCACCATGTATGGCCGACGACGGTAGCCGAAGATGGGGTAGCAGTCCGAAATGAGGCCGGTGAAAACTCGAAGAGCGTGTGGAACTC
TCACAAGCGCCTGTGCGGTTGCAACAAGCACCGCGCTCATGTTGAGGTAGTTGTTCAGCACGGAGTAGATGACACCGGAGATGGAGCCATACACGATAGC
GACGGAAATCTGATGGGCTGCCAGACCAAGGTGCTGTCGTGAGTACAGCGAAGACGGCGGACCACCGGGCCGAAGTGCTCCGCCTTCGAGGTCAGCGGGG
GACTTGAGACCGTCGTAGAAACCAGCAGGAGCAGGAGACGCCACCTTCTGCGGTTGGCTGTTGCTCGCAGCGGCGAAGGAGAGAGAGGAGCGCTCTGCGG
AGGTTGGAGAGCCCATGGTGAGCGAAAGCAAAAACGGAAATGGACATCGAGTTGCACGTGCTTGAAAAGCGCCAACGGCGAAACAACGTAGGTTGCGTAC
GAGTCACCCTTTGGGCTCATGTCAAGGTGAATAATCCCCGACAAGTTCTACTCTGGCACGTGGCTCGGACCAACGGGGCATGAAGATGGTGCCTCTTACC
TCCGCACGACCTCGGTCCGCTCCACAGACAAGTGCAGCAGCAGACGCGGCTCCAAGGCATCATTCGCTTCTTGCCAATCGTTCCCAGTACAAAGGTGGTT
GAGATGGTACCAAGTGATGACTGCGAGGTGCTTGCAGCGGTTTGTTGCTTCGAGCAGCGGCGCGTGTGCCGCCGCCCAACGAGAGCTTGTCGCCAAGGTG
CAAGCAAAATGTCTCCAGTCGCGGCGTGGCGAGGCCGCTGAAAACCGGGCCATGCAAATCTGCGAAGCGAGTAGTTTGCTAGTTGGTCTGTGGTTGATTG
GTCTTTGGAGTTGAAGCTTGTATCAGGACCTCGGGCAGGAAGATAGAGAAGATGATGAGACCGAATGGACGCACTGCAATGGAGCCTCCGGGAGCTCAAG
GTCCTGTCCGCAACGGGATCAAAGGCATCGACGGATCCCCACGATTGGGTAGCGGTGAAGAGCCTTGCAAATTGCTGTGTCGGCGGGCTCTGTCGCTATC
TGCTGAGCCCGGACACTTGTTGCTGAGATATCATGTCGATCACGCATCGCGGTGTCCGCTCGGATCAGATGACCGGATGCTCATGGATTTGATAACTCAG
CAACGCTGATTACAAGATAGACCCCAAACTGCGGTGGACTTCACGCTACTGTTAGTAGGTACGCCCGCGTTGTTATCAATCCAGACGCCAAAGACACGCT
ATCAATCCTGTCAAGGTAAGTTCAATCGTGTAGCCCAGGCGTTGGCACCAGTCGGCGCTAGTTGTTGGATGAGCAGCCACAAAAATCCGACGGATAAAAT
GCCGCGGCCAAGAGAATAATGGTGGTCGATTGTCCGTTCCTTTCGAACCCAGTTAGTTTTCCGCCAACTTGCAGCACTAGCTCGATATCCTCTAGGAAGC
TGTCGCAGTTGCGGCAGCGGCAGAAAGCTGGCGTACGATGTCCGGATACTGCTGCTCAATCTGCTCGGCGCATTGGTTCACGTTGAAGCACACAGAGCTG
ATTCGCGTGTCAAAAGCTGCCAGAACCTCG