Description :
From Genome Similarity Track
Location :
Scaffold_3:52740- 55628
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_3-abinit-gene-0.157Choline-phosphate cytidylyltransferase B

Sequence
2888 bases(100 bases per row)
CGTCTAGCACAAGCCTTCGCGCGCCATGTCGGACAAGCGCTCCGAGAGCTTCTCTTTGATAATCTTGCGGCGCTTGCGGAACGACGTGCGCTGCAAACAC
AAAGCAAGTATCCCGAAAATGTGAGCTGCGGCAAGTTGGAAGCAAAACAACCGCAGCACCGTACCAGTCGGCCTTCCTTGCTGAACAGGTCTAAGAAACC
GTGTTGCATGTCGTCCGCGCGATCCTTCCACTTGTGCAGGAAGTTGTCGACGTCGTGCTTGACCTTGTCGACGGCAATGTCCCACTTGATGCTCTGCTCC
TTGATGAACGGCACGTTCATCTCCTTCCCCGTGTACCCGCGCTGCAGGTTGCGGCGGATGAACGTGTCGTACTCGGCGATGATGCGGATGATGAGGTCGG
ACGTCGAGATACCGTCCGTGCGCCGCGTCTCGAGGAACTTGCCCATCGCCTTGATGCGCGCGTACACGTCGCCCTCGCTCGCCTCGCCCGACGTGTCCGA
GTACGGCAGCGCGTCGTGGCACACGTAGTCGATCTGGTGCTTGTCGATGAACTCGTCCGTTATCACCCACGGCGCGTCCTCGACGACCTCGTCGACCCAC
TTGCAGTGGCGCAGCGACTCGTAGCGCTCCTGATCCGTCATGACGGTGCGTCCCTTGAGCTCGTGCGTCAGCTTGTCGCTGCAGCACCCGACCAGCAGGA
ACGTGTTCGGGTACGCTTCTTTACACTGCTGCAGCGCCTGTAGTCGCACAAAGCGCAAACCAAGTCAGCGCCTCCATCTCCCCCTCCATCCTTCCACCAC
ACAAAGCACCAACCTTGGCATGCCCGAAGTGGAACAGGTCGAAGATGCCGTCCGCGTACAGCCGCAGAGGACGGCCCGTGAGCGTGCCGGGCTCGCCCTC
GACAAGCTTCTTGCGGTACGGTTCGGGCTGCTCCTCGTCCTGCTGGCTGCTCGAGTCAGCATCGCCCGAGTCGGACGACGCAGCCGACCCGGCCTCTTCG
CCGCGCTCGTCCTCCTTCTCCTCGGCCGCGAGGCGCGCCGCCTCGCGGTCGTCCTCCGCCTCCTCGGCGTGGTTCATCTCTTCCGCGCGTCTCTGCTCAT
CCACTCACAGCGTCAGACGGCTCGCGGAGCAGCAGCTACCTTCCTAAGTAGGGGGGATCACCTTCTTGGCCATTGCGATCCGTTAACGCTTCCTTCGGCA
GTGACTGCCGCGGTCCTCGGGCGTTAGGCGCAGCTCTTCGCTCTGCGGCGGTAAGTGCGCGCTTTGAAGGGCGTTTCGAATGTTTCGCCGATTTTTGTCG
GCGTGTTGTTGGGCGGCAGGCGCGAAGGCGCGAAGCCAAAAATCGAGGGGGATCCTTTTTTTTTGAAGAGGAAGCGAGCCATCGTAAGTGCGCAGGCGAA
CTTATTAGAAATAACGGAAACGATGGGATTAGTGCCGGTTGAAGTCGCCGTTTGGTCACACCGTCGCGAGGCTCACGATGCGGGAGCTGCCCGAGAAGAG
CTTGTGCGGGACGTTGGCGAGCGCGCCGCGCTCGAGACCGACGGGAGGCTTGACCACGATCGGCACCTGCCACTGGAACTTCTGGCGCTGCATGCGCGCG
CCGCCACTCGCAGTGGACGCCTCCTCGGCCTCGACAGGCAAACCCGCGCAGAACTCGAACCGCAGCAGCCACTGGAAGTTCACCAGATCCGTTCGGATCG
TCGGCAGCGCGTCCTGAGGGATACAGAGACGGAGGTTCGTCTGCAGCGCGCCATGCGTGCTCTCCTGGAAAGACCCAACCACTTTGGACTGCACGACGCG
GTCCGGGTCGAGCGACATGGACGCGAGTTTCTCTTCCAGACACAGCGTCGCTGTGATCTCGTAGCACGGGATGCTCGCGCGAGTGAAGTCGAAGACGCCG
AGCATGATCTCTCCCGGCTGGTAGTACTGCTTCGTGAGCAGGAAGCGCACGAGGTGGCTCGTGTCCTTGCCGATCGTGAAGATGCTCGTCTGTGCTCGCT
GCAGCAAGTCCGTCTCGACGCGGCCGTGCATCAGCGCCGGACGCAGCTCGAATGCAATCTCAGTCCCCTTGCGCACGCTCACTGGCGCTGGCGCGAACGA
CGTGCTGCGCTCCAGTCGCCGGCTCTTCCCTCCACTACTGAGTCCTGATCCTGCAGCGGTAGGTTGATCGCCATTTGTGTCGGTCGATTCACCCTTCGCC
TGCAATGCCGCATACTGGTCCGCGCTCGCGATCGTGCTGGCCGCGAAAAAGTACTCGGACGCGTACACCTCGAACGCCAAGTGGACTGACACGGGCTTGC
TGGTCGGGAGTCTGCCTTGCGCCGTGATGGACACAGCATAAAACACTCGCGCCGAGCTGCCGCGGAACGTAGGGCACACGTGCTCAGGCAACGCGATGGC
GAACTCTCGCGTGCACCGCTTGATCCGCTCCCTGGATCCTGCATCTCCGCCCTGGAGCTCCTCGGGCGTCGGCGCCACGTTGATGTCCGACAGCAGCACG
GACGGCGCCGACTGGTAGATGCATGTGCCTGTCTCGCCAGAGAAGCTGCGCACGTCCGGCAGCGCCACGCCCATCTTGTCGAACAGGAACACCTCGCCCG
ACATCTTGCGCTCCAAGTGCGCGCGCTCGTCCTCGGAGGCTGCGCGCGGGGACGTCACGTGCACCACTGGCAGCGTCAACAGGTTGCTGTCCACCGTCAC
ATGGCCGTGGACCTGCGCCACGACGTACGCGACCTCGGACGCCGCGTCCGCTGCGTGCTGGCCAGTGCTGAGCAGCACGGCGCCTCGCACGACGCCTCCA
GGGCGGAAGTAGCGGCTCGCGAGCTCCGCCGAGAGGCTCAGGCCGCCGCCAGGTGCGCCGCCGTCCTGCGTCATGACGTGGCCGACTG