Description :
From Genome Similarity Track
Location :
Scaffold_1055:5273- 6634
Transcript NameFunction/comments
Phyta_totarag11877hypothetical protein
Phyta_totarag11878hypothetical protein PHYSODRAFT_362017

Sequence
1361 bases(100 bases per row)
GAAAGCGATCGTCTCATTTTTGGACCTGATCCGAGGCGAGGGATTGCCTTCGCTCACTGTGTTACAAGTTGACTATGCACAGAGTCGCTCCGAAGGCCAC
GATCTTGTCCAAGACACTTTGAGACGACGGAGCGTCCAAGAACTCGTACGTTTGCTCATTatcgtctgcttcttgctgctatTCGCTGTGGCTTACACCC
ATTGTATTCTCCCGGCCACTGCCTAACGTACAGAGGcgactgaagcagcttcgttTCGAAGAGAGATTGACCACCATTCAGCTTGAAAATGAGGTGAAGG
CAGAGCGAGGCCAGattcgctgtcgtcggcagACTCAACGGCTGCGGGAAGTCTATGACCATCTCGAAAATGAAGCTGATCGAGCCTTGCGTCGCCGCAA
GCAACTGAAGAAATCTTCTCAGCTGCATATTCACCAGGAGATCATGCGTCAAAAACAGCAACGCGCACATGCACGGCTCAGCAGAAAACTCGACCTTGAT
GTCCATGCAGCCTAGCAACTGCATGGTGATCACAGTCAAAATCATGAAGACGTCAACGAGTGAGGTTCTTGCCCTACTGTTCTAGAAAAACAAAATAGAA
TGGAGGAGACTCATTATTGCCGTTAGCAGGAGCAGCCATGGACAGCACACTTGAAGTAAGCTGCAGAGCACACAAACTACCTTAAACATTtgcaaaacac
acaaaaaaaATATCAACATGGTCCGCTCCTGTGTCTCTCTCGAACCTTaccaagcagcgccagctaACTGAGCAGCATCATTCTGACGCTGGTGGGCTGG
CCAACTTCTCAGCCAGtttgagcagcacgttcgTCTGCGCAGCCATCATCTGCAGCTGTTTATCGGCagtctgtcgctgctgctcgaaccGTTGTTCCTC
TAACTTGACACGTCGttcctccagcttcatcCGTctctcctccagctccagttcccGTTGACGCAGTATCACTCTCGGGTCATTCAGCAAAAGTGTCAAA
TCTTGTCCCATCGGCGCCGTCTCCGTTCtggccgtctccgtcgcATCAAACCCACTAAATTCAGGGTCCCCACTACTCGCCAACCTGGCTGCATCTTCCA
TCGCTAACTGTGCCACTGGGGGGTGTCTGTCCCcctccttcatcatcttacgtcgtcgatgctcctcctccatctaCCACAATATTACAATAATCATTAA
CGTCATATTGTACAATAGCATGATAACAAAACTTGAGACTTGAAAATGTACCATAACGAGGCACTGGCCCAGGATCTTCTCCCGCTGCGTGTTCATGGCC
GGCGTGCCCGAGCcccgcagcttctgcagcttctccgtgcCGTAGGCTTCCGCTAGAGACA