Description :
From Genome Similarity Track
Location :
Scaffold_7:527276- 529074
Transcript NameFunction/comments
Physo_129315hypothetical protein

Sequence
1798 bases(100 bases per row)
TGGTGTGTGGTGCTCTTCTTTCATGTTTTCAACGCTGTTTACGCGAGCTCCCTCGCGTACATTTACCACTACATGGCATCGCCTATCATGGACTATTACG
TTCAGCTGCTGCAAATGATGCCGCAGAAAAACTACAGCGGAGTCATTACCCTCTACGCGTGCATCGGAGCCATGAACTTCTACAGCGCAGTGAAGATGTC
TTGTTACTCGCTGTATTACAAGAGATTGGTATTCGGCAAGATGAAAGACCTGCAGAAGTTTCCGGGTGATGATGATAGAAAGATTCCCGAACGGCTGACA
AGGTTTCAGGCATTCAAGCGTTTTGCTGCTGGATTTGCACGAGCTATCAGTGCGAGGGGCGAGTGGTTCGACGTCGTCTTACTTATGCGGGAGGTCTCGG
AGATCGCTTCGCAGACCGTCCAAGCGCACTCCTCGAGCTTCCTCATCAGCAGCGTTTGGATGAATCAGGTGTTTGCAGGCTTGATCTTCTTGAATACTTT
CGCGAACACGCTGGTGCACTACAACCTAGAAGAGAAGGTGGGTCTGAGACGTTTGTACAGCACTGCGATCGACCTGGCGCTCGATTTTGCGTGGGGATTC
CTTATCCCCTGCAAAATCATATTCGTCTACATATCGTTGTTTATGGAGAACGACGGATCGTTTCCAGATGATTTCAACAACTCGGACACGCTGATGATCA
TGGCGATCCTAGAGTGCAACCAATTTTTTTATGGTCAGTTGGCTCGATGCCGTCACGACGACTTTACCCTACTTGAACATGCTGTCGGGTTTACGAAGCA
TAAAGTTTCTAGTTCAGCATGACATGGAGGTGATTCGAGCTGTGATGTCGGCAAAAGTCTGCCCCACAGAGGCAGCGCTGAATCTTGCTAAGCTGGAGAA
TGTAGTACTTCCTGGCCACCAGGAAGTCCGAGTATCAGGTAAAGCACCAGCTTTTGAGGAAAATCAGGTTGAAACCAAACGCAGTATCTGGGGAAGACGA
GTTGCAGCAGGCATTGTGGCGATCATGCCTATTTGTGGTGTATTTGTGCTGCTCACCTCCATCGCGTCGTCAGGAATATTTTTTGGGAGTGATGATACGT
GTGCAGCGGGCTGCAAACTGCGAATGCACCCGTAGTTCACACGTCAGTGCGCTTGCTCGGTAATGGAAATCAACTGCTTCGAACGAGGTATCACTGGTCG
TGAGAGCGAGATGCGAGATATTTTCCAGTCCCTGGACGCTAGAGTTCTCAACTCTCTCATCATCTCTCACTGTCCCGAGCTTGTTGTCACCGAGGATATC
CGCCGCTTCGGCAGTCTGAAGGCGCTTGAGTTGTACAACTCAACAATTATCGAGTGGCCCGCGAATGCGTCCCTTTCACTTCCCCACCTGCCTTACCTGG
TCACTCTGTACATCGTACGCTCTCGACTTTCCGGTCTGCCCGACGGCTTGACAAGTGACTTTTCATCAAACATCGTGGACGTTGAATTCGTGGCGACCGA
CTTGGGTGGACCGTTGCCTGACGACCTTGACACGAAGTGGCCATCGGTTGTGATGCTGTACTTGGAGCATTGCGGGCGTCAAGAGTTCCCGACAGCTCTG
TCCAATATGGTGCTGATAGATCTATCGCTGGTGGATAACAACATTTCCGTAGTCCCCGACAGCTTGAGCGACAGCTCCATGTACGTCATGCTGGACCGCA
ACCCGCTGGATCGCATCCCGGACAGCTTTGGGTCGCTGGAACAGCTGAACTACCTCACAGTTCAATACACCAACATATCGACGTTGCCTCCGTGGCTG