Description :
From Genome Similarity Track
Location :
Scaffold_8:527238- 532507
Sequence
5269 bases(100 bases per row)
CTAAGTCTTCCTCTGACTTAAAGAGCTGTGTAGCTCCGCTACACTTGGTAGCACTTGTAGTCAATCTACGCCTGAGTCTTTAAAGACTGATCCTCTGTGA
GGATGGAAAACGCTACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGATCCAGAGTATGCGGAATTCCTTGTATCGCA
AGGCCCGGATGTGCTGACTGCACATGTTGAGGGCTTCTTGCAGTATGAAGCGTCCCTTCTAGGGCAGGTCCAAGACCAAATGGCGTCGGCGATGCCTACA
CGCTATGTGTCTGTTCCAGACGAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAAGTTAAAAACTACTCAGGAAAGGGGGGTGAAAACCTCATCCTCTCGA
TCCGTGAGATTGAAATGGCCATGAGATCAGGCATGATCAAGCTTGACCATCAATAGGTCTCTCTGGCTATCTCAAAGCTCGATGGAAGAGCTAGAGAGTG
GGCCTTGACGTGTAGCACGTCGGTCGACTTAGCGTTTTCCACATGGGAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCTAACCAGGCTTAC
CGCGTGCGTTCACGCTTTTTATCAACCCTTCAGGGTAAGAATGAGTTAACGGACTATGTCCAAGAGCTGAGAACTCTCATGGCTGCTATGCAGTCTGACC
GTCTGCCTGAGACAATCCATGTGACTATATTCATGAAGGGTCTCCGTACTGGCATTGCCAGAACCGAAGTCTTTCGGGTTCACCCCTCTACATTCGAAAA
GGCTGTGAGAAGTGCTCTTAATGCTGAGCATAACTTCAAGTCGGCCAGGCTTGGCTGGAATGGGTACAACCCTAGTTCTGCGAGAGCAAACTCCACGAGT
ACTCCGGCTGTTAATAGGACAGAACCGATGAATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAATCTGCTGAGCAGCAACGTGTCGTACGAT
ATTGTTATACGTGCGGAAGCACTAAACACTTGCGGCCTGATTGCCCTTTGCGTAGACAGCGCCAGGCTACGAGTCAATACTCTACCCCGAGCCGAAGTCT
GGCATGACACGGGGAAATGCCGACACCCAGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTTAGGAGGTAACGTTGAACAGGG
CTTAGCCCCAAAGAGTTCCATACCTACTGGTGTGTAGCGTGGATACAAGTATGGCTTGTTGGTCGCTGAGGCGAAAGTTAAAGGCTTTGAAAAGCCTTGG
TCGATTTTAATCGATTCTGGGGTGTCTTGCAATTATGCTCGACGTCTTTCCCTTTGAGGGAAGTCAGCGTTATGCTGAAGAGCTTACAGCACATGAGGGT
GATTCAATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACCGTACCTAAAGTTCCGTTGAACTTAGGTATAAAGGTTTTGGACTTTGATAGCATTGAAC
GCTGTCTTGTCCTTGATTTGGACTCGAGGTATGATCTCATCCTAGGTATGGCTTGGCTTGAAAGCCATGAGCCATGGATTGATTGGAGGTCGAAAACCTT
AGGCGCTACGCGCAATGTTCCTAGATAAGTTTTGGAGAGTCATGAACCCACCTTTGCTAGGCAACAAAAGCATTATTGGTGCGAGTCTTTGACAGAAGAT
GTCAATGTGCTGGACATTGGAATGTCTGAGTCAACTAACTCCGATGTTGAAAACATGAATTCCGAGCGTAGCTCGTTGAGTATTAGTGACACGACACTTA
CTCCGTTGAGTGTTACTCGTTGTGATAACGAGTCACTACATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTGATGAAAAATGTGATTCCTTTGATGTGTG
TGTGGTGGCACGTGAAAATGCACGAAGTGTGGTCGGCCGTGAAGGCACCACACTAAATGTCGGTAATGACATTGTTGGCGAAACGCCATTAAGTTCAGGG
CTAGGCCCGTATAATGTAAGTGGAGTGGCACGTTTGAATCCACTGGGTGAAGTGTTCGAGTTACGTAACACTTAACCGGATCTCGGTCAAGACATCAACT
CTCGTATAGAGCGTACTACTACTAGTAGTAGTAACCATGGGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGACCTGGACG
CCAGGTGGCAACTGTTAAGCGCCAGGCGTCCGAGCAGTCACATAGTGACAATAGTGATACACTATATACACTTGTCAACGGAGTGACTGGCCAGGTCGAG
GGCAATGTTAGCCTGTAAACCCTTCCATCTTTAGATGCTCTTTGTGAGCTAGACGAAATGTCTGATGCGAGTTTATCCAGGCCTTGAAGGCAAGAGATTT
ATCCAAATTAGTGGTCATTAGACCCGATGTCGATTTGAACTCGTCCTCATTAATGGACGAGTCGGTCCTAGAGGATACCAAGGCGGTGCTCAGTGCCCGG
AGTGGGTCTTCGATTCTTAAGGGTCCTTTGGATCCATTCTATCCTTTGGTAAAAGAATTTCAAGATGTGGTGTGTCACAATCCACCATCTGTTTTACCTC
CCGATAGAGTTTTATGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCATAACACGGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTGA
CGATTTCTTTCGTGCTAAGCACGCAGCGGGAATGGTGCAGGAGAGTAAGTCTCCCCATTCCACACCGACATTTTGTGTCAAAAAGCCTAATGGTAAGTGG
CGCTTATAATAATTTTAATGCTGCCACTATCCCGGCTCAGACATCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATTGTACAGT
GCGCTCAACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCTCGAGCGGTATGCTCTGGGAGTGGC
TCGTTATGCCACAAGGGCTGTCAAATGCCCCGGCTACTTTTAATCGTCTGGTGAAGCAACTATTCGGACCTCATCGAGGCTATGCACAAACGTACTTTGA
TGACATCTTTGTCCATAGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATACGCACGAATAAA
TTGTATCAAATGCATCTAAGTGCATCTTTGGTGCAGAAGAGATTCCCTTTCTGAGGTGCTTCATTGGGAAGCAAGGCCTTCGAGCGGACCCCGCCAAGAT
AAGGCCATAGTCGATTGGCCGGTTCCAAAGAACCAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAGTGCGAATTACGCAG
ATATGGATCAGCCATTATCCAATCTCCTTAAGAAAGATGTGGATTGTTGTTGGAGTAATACCGATTATGATGCTTTTCAAGCAGTTAAGGAAAGTTTCCT
TCATGCGCCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAGGCATCGCTCTGTTATAAACAGAT
GTAGATGGACGCGAACGCGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAACTTCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTA
CGCTCTAGTCAAATTCAGAGTACATCTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTC
TCTCAGAGAATGGCTCGTCGGCTTTCATTATTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGATTTGGCTGATGCGCTATCGC
GCCGGCCTGAGCTTGCTCACGTCACTACGCTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTCTGCTATG
TGCTCTTGGGAGCAAGGAGTTGAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCCTGTTGTGC
TATCGCACAGATATTGAGGATAACCCTCGTATCGATGTCCCTCATGATGAGGAGTTAAAGTATCGAATCCTCTATGAGGCACATGATACCGCTTCAAGTG
GTCATCTCGGTCGTGAGAAGACCTTTAGCTCAGTGAGACAGGCTTATTGGTGACCCAAACTATACAAGTGGGATAGCACCTATGTGCGTACGTGTGAAAC
GTGTCAACGGGTGAAATCCTCAGCACATGTGGCGGTGCCGCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTT
GGCCTACCGAAAGATTCGGAAGGCAACACTGGCATTGTAGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTCTATTGATG
CAGAAGGTACAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAACATGGATTTCCAGTGGCAATTGCTCTGATAGAGATCCCCACTTCACGGGGAAGTTT
TGGAAGTCCACCTGCAAGGTGCTTGGCACCCGTTTGGATATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTGTTAATCGCTTCATTA
ATGACATTTTGCGCAGGGTTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGCTCCCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCTAC
AGGCTATACTCCGTTCTAAGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAATGCTACTACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTTCCGAT
CGGCTTGCTGATATCAGCCCTGAGACTATTCAAAAACAGGTAGGAGGGTTTCTCGCAACGCGATTGAATGCCTTAAGACATTTGCGTGACGCAATGGATG
AAAGACACGACCAACAAAAACGACAAGCAGATGCTAAAAACTGAGGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGCTAAAAACAT
ACCTACAAGTGTAGTGTCCGCTGTCTTCAAGACAAAGTTGCGTCCGCGCTTCATTGGACCATTTACGGTCACTTCCAAGAAGGGACTTGCGTATAGGCTA
AACCTTCCGCGCAAATTGCGCACACAACCAGTGTTCTACGTAGGCTTACTTAAGCCATACCAGGATCCT