Description :
From Genome Similarity Track
Location :
Scaffold_417:5272- 6796
Transcript NameFunction/comments
Phyta_totarag8110hypothetical protein

Sequence
1524 bases(100 bases per row)
AGTCCAACACAATTATTTTTTTaggacaacttcaactgaCGGTGAGCATCGCATTGAGCTGCAGGTTGCCACTTTGAGTAGATCGAGGGACCCACAGTAA
CAAGGAACCACCTCCAGTCCCGGGAAGTCCCAGTAATCCCGGACGCCATCGGTCCAAATACAGCGTCTTTCCTTCCAGTGTCGTGACATTCGAGGTCCAG
ATCACAGTCCCCCCAGTGCCCACGTCCACCTCATCGATCTTGTCGCCCCCGGAGTGGATGTTCACGGTAACGTCTGTAGTATCAACACTCTTGAATGTGA
TGGTAACAGTGCGATCGCCGACCTTGGTCCATGTGCCGTCACTGTTCGTGAAGGCGCCCTGGACGATCGACATTCCCAACGCCTTTTTCGCAGTCCCGTC
GTCGACCTCCCCGATGAGTTCTGTCGGACCGCAAATGGGCTGAAAGTACTCGGAAACTGTACTAGCTACACCCCACACATCCCAGACAGCGTAAAACGTT
AACGCCTTATCCGCGATCTTGAATACGTACTCTTCAGCTGAGAGAAATGTGCAATGGCACATTTCTCTCAGCTGCTAGTTCCGGAACTGATAAGGTCATC
CAAAATTCCGCTACAGGTCTTCCGCAGTGTGTCACGTGTGGCGTATGCTGTGGTCTCATCCGATTCTGCGATCAACTCACCCATGCAATTATTTGTCGCC
ATAGGGATATCGTTGTGTACGAGATTTGACTGGCTCATGGTCGCTCGAATGTCGTCCTCAGACATTTCCGGATTCTGTTTACGAAATTCTGCCAGTCATC
CACGTGCGATCCAGCAAACGTTTCATGTCGTAGCCGCAGGTGGAGTTGGACTCCATCGCAGACTTCAGAGATGAAATGTCAGTCTCGTTCAACGAGCTAA
GCGAGTCGCCAAGTGTGACATTCTTCATGAACGCTGTGAACGAGTCCCAGCTGGAAACAATTGCGTCACCATTAGCCAAAACTTCCTTCAAAGTGAGTTC
AGCTGTGGTAAGGAATCTGTCGGCAAACTTTACGCTATCGTCAACCTTGATGCCGAGGCACGAAACAACTGTCACGGATATGTCGATAACCACATTGTCG
GACTGATACAGGATCGTCAATAACTTGGCTTGTGAAGTCTGCGGATCGGACACTTTAATTGATCGAacgtacttggccagcgacTTGATCAAACCCAGCA
TATCCTTGCTACACTTAATAGCGACTTAAAGACCCTTCGCCATCAACTTAAATTCGCCATGAACACCGAGCGTCGCGAAGGATAACGCCGACTGGGCAAC
GACCTAAACCTTGCTCACAATTTCAAGTGCACAGTCGTCGACGGGATACGAATATGGGCACTGCGCCCAACACATACCAAGGTTACTGTTAAATCCCAGT
GAACACATCTTCGCGACGTGAGCTTCCCAGTAGCACGCCCTGGTGGATGCAGTGTCGAGTGCCGAACCTACCCAGTTGACATAAGTAGACTCAATTGTGC
TAGTAGCGTTAATGGCACTGCTAA