Description :
From Genome Similarity Track
Location :
Scaffold_884:5272- 6557
Transcript NameFunction/comments
Phypl_g11449hypothetical protein PHYSODRAFT_536296

Sequence
1285 bases(100 bases per row)
AATCAAGAGGTTCAAAGCAAGATTGGTGATTCACGGCTTTAAGCAACAGCTGGGGATCAACTACTCTGAGACCTACGCACCTGTGATCCGGGTTGAATTT
ATTCGTGCGGCAGTCTACTTTGCTATCCAGCGTGGGTGGGAAGTGATGTGTAAACGGCATTCCTGTATGGCGACCAGACGGACGGACCATCGCTGGTCTG
TCAGCTCCCGAAGAGTCTGTACGGGCTTAAGCAAGCGCCGAACATCTGGAACAAGACGCGTCACGCGAAGCTGTTGGCCATGGGACTAAAACGCTTGGAA
TCGGACTTCGGACTCTATGTCCTGAAGAAGGTCGGCGAAGTGACGCTACTACTTACGGTTTACATGGATGACCTACTGCTGATGGGCCCTTGCAAGTTGT
ATGAGGAGGTTGCTGCCTCTCTACAAGAAACATTTGAGCTGACTACTATGGGTACTATAAAGTATCTACTAGGAGTTGAGATTCTCATAAACCGGTCCCG
GAGACAGATTGTGTACTCGCAGCGGCAATAcgtgctgaaggtgctgaagcgGTTCCACATGGAGAACTGCAACGGATGCGCAACGCCGGAGGCGACAACC
CCATCGGCGGCAGCTGTGTCTACCTCGAAGGAGTATCTGCCGTACCGTGAGCTGGTTGACGCCCTCCAGTACCTGGACAGTGCATCAAGACCGGATATTG
CACATGCTACGAGACACTTGGGCAAGTACCTGGTCTGCTACGACCACACGCCCTACGCACAAGCAAAGTGGGTGCTTCATTATTTGAAAGCGACAAGAGA
CTACGGCTTGGTGATGGACGTGAACCAGAATGAGGCGTGTGTGTTAGCGGCTACTCCGATGCGGATTATGCGAACGACCCCGTGGACGGGAGAAACATCA
GTGGCTACGTGACCATGCTGGATGACAACGTGATCTCGTAGCCTCTAGGAAGCAGGAAATCAACGCACTCAGCACATGCGAAGCTGGGTACGTTGCGATG
GCAGAAGCAACCAAAGCTCTGCTGTGGCTTGCTGGTCTATACAAGGAATTTGGCTGGAAGCATCCAGTGCctttgctgcttggcgacAATCAGGGTGCTA
TTGCATTGACGGCGAAACCAGGCAAGCATTCCAAGTTAAAGCACATTGACCTCAAGCATCATATGGTGCGACGggacgtggagctcaagcgtCTCACGAC
GCAGCACATTGGCACTGACGAGATGGTGGCCGACGTGATGACCAAAGCACTTGGTGCTGTGAAGTTCACGCAGGTTCGGACAGAC